Megashortscript t7

Manufactured by Thermo Fisher Scientific

Sourced in United States

The MEGAshortscript T7 is a reagent kit designed for the in vitro transcription of RNA. It utilizes the T7 RNA polymerase to generate high yields of RNA from DNA templates.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

MEGAshortscript T7 kit (228 citations) MEGAshortscript T7 Transcription Kit (218 citations) MEGAshortscript (11 citations) MEGAshortscript T7 High Yield Transcription Kit (9 citations) Ambion T7 MEGAshortscript kit (4 citations)

19 protocols using megashortscript t7

In Vitro Transcription and Protein Purification

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

In vitro transcription was carried out using MEGAshortscript™
T7 (LifeTechnologies, USA) and T7-tagged PCR products
amplified with primers 5'
-ATTAATACGACTCACTATAGGGCTCAGGGTTCCAGG and 5'
-TGCAGCAGGGAGGACG, and DNA of the indicated plasmids as a template. Indicated
synthetic RNAs were purchased from Eurofins UK. Five hundred pmols of each RNA was
treated with 5 mM sodium m-periodate and bound to adipic acid
dihydrazide agarose beads (Sigma, USA). Beads with bound RNAs were washed three times
in 2 ml of 2 M NaCl and three times in buffer D (20 mM HEPES–KOH, pH 7, 6.5%
v/v glycerol, 100 m M KCl, 0.2 mM EDTA, 0.5 mM dithiothreitol), incubated with HeLa
nuclear extracts and buffer D with heparin at a final concentration of 0.5 mg/ml.
Unbound proteins were washed five times with buffer D. Bound proteins were separated
on 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis, stained by
Coomassie blue and/or blotted on to nitrocellulose membranes.
Western blotting was carried out as described (7 (link)). Antibodies were purchased from Sigma (hnRNP E1/E2, product number
R4155, U2AF65, product number U4758 and SFRS2, product number S2320), Abcam (DHX36,
product number ab70269) and Millipore (SC35, clone 1SC-4F11). Antiserum against hnRNP
F and hnRNP H was a generous gift of Prof. Douglas Black, UCLA.

Kralovicova J., Lages A., Patel A., Dhir A., Buratti E., Searle M, & Vorechovsky I. (2014). Optimal antisense target reducing INS intron 1 retention is adjacent to a parallel G quadruplex. Nucleic Acids Research, 42(12), 8161-8173.

+ Open protocol

+ Expand

In Vitro Synthesis of gRNA and Cas9 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

For the synthesis of gRNA, 1 μg template was used in transcription in vitro with a half reaction system (MEGAshortscript T7, Life Technologies, AM1354). The product was purified by phenol-chloroform and ethanol precipitation and stored at -80°C.
For the synthesis of Cas9 mRNA, the pGH-T7-zCas9 plasmid was used for transcription of Cas9 mRNA. The plasmid was linearized using XbaI (New England BioLabs, R0145S) and column purified (QIAquick PCR Purification Kit, QIAGEN, 28104). We used 1 μg linearized plasmid for transcription in vitro (mMESSAGE mMACHINE T7, Life Technologies, AM1344). For Cas9 mRNA used in multiplexing co-injection of 6–7 gRNAs, a 40 μl reaction system was used, and the products were column purified (Zymo Research, R1016) to increase transcript production and meet the concentration requirement. For Cas9 mRNA used in co-injecting of 1–2 gRNAs, the RNA products were purified using a kit (RNeasy MiNi Kit, QIAGEN, 74104). All the products were titrated with a NanoDrop 2000 system.

Chen Y., Zeng S., Hu R., Wang X., Huang W., Liu J., Wang L., Liu G., Cao Y, & Zhang Y. (2017). Using local chromatin structure to improve CRISPR/Cas9 efficiency in zebrafish. PLoS ONE, 12(8), e0182528.

+ Open protocol

+ Expand

CRISPR-Generated TRIM23 Knockout Mice

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

TRIM23 KO mice were generated using CRISPR/Cas9 genome-editing techniques. Briefly, a 20-bp guide sequence (CGTATTGCTCTTCCATGCAG) targeting TRIM23 exon 2 was cloned into pSpCas9(BB) (plasmid 42230; Addgene) following a reported protocol (59 (link), 60 (link)). Subsequently, Cas9 mRNA and TRIM23-targeting sgRNA were produced through in vitro transcription by using mMESSAGE mMACHINE T7 ULTRA and MEGAshortscript T7 kits (Life Technologies), respectively; both Cas9 mRNA and the sgRNA were purified using a MEGAclear Kit (Life Technologies). A single-stranded DNA oligo (ordered as Ultramer DNA oligos from Integrated DNA Technologies) was used as the donor for homology-directed repair; the oligo included a 19-nt insert (TAGATAGAATAGGAATTC), which contained three stop codons in different reading frames and an endonuclease EcoRI site, and two 60-nt arms.
Different concentrations of the Cas9 mRNA, sgRNA, and donor oligo, as reported previously (59 (link)), were mixed and injected into 200 fertilized eggs of C57BL/6 mice, and the eggs were subsequently transferred into the uterus of pseudopregnant female mice. The resulting newborn mice were genotyped using PCR: the sgRNA-targeted region in genomic DNA (extracted from ear-punch samples) was amplified to determine whether it contained the 19-nt insert; positive PCR results were further confirmed through DNA sequencing.

Cao X., Zhou Z., Tian Y., Liu Z., Cheng K.O., Chen X., Hu W., Wong Y.M., Li X., Zhang H., Hu R, & Huang P. (2021). Opposing roles of E3 ligases TRIM23 and TRIM21 in regulation of ion channel ANO1 protein levels. The Journal of Biological Chemistry, 296, 100738.

+ Open protocol

+ Expand

Generating Zebrafish Mutants using CRISPR

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

met zebrafish mutants were generated using methods previously described [46 (link)]. In short, gRNA (guide RNA) targeting our gene of interest coupled to a scaffold gRNA was transcribed using the MegaShortScript T7 (Invitrogen) and co-injected with Cas9 protein (New England Biolabs) into one-cell stage zebrafish eggs. Injected embryos were grown to adulthood, outcrossed into wt zebrafish and screened to identify founders containing germline mutations. For met, gRNA targeting exon 2 was synthesized using the sequence CCTTCACTGCGGGGGAACTATCC. One frame-shift mutation was identified carrying a 2 bp deletion (Fig 1A). Genotyping was performed using forward 5´-GGGCACTCAGATCCTCAACA and reverse 5´-ATGCACTCAAAGGGCATTTC primers, the product was then digested using the BtsI restriction enzyme (NEB) generating 2 products (180 bp and 177 bp) for wt and no digestion of the product for met mutant zebrafish (Fig 1C).

Nord H., Dennhag N., Tydinger H, & von Hofsten J. (2019). The zebrafish HGF receptor met controls migration of myogenic progenitor cells in appendicular development. PLoS ONE, 14(7), e0219259.

+ Open protocol

+ Expand

Generation of CRISPR/Cas9 Engineered Mutant Mice

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mutant mice were generated using CRISPR/Cas9. Guide RNA (sgRNA) constructs were designed with ZiFiT Targeter (Sander et al., 2010 (link)). The sgRNA constructs were transcribed in vitro using MEGAshortscript T7 (Invitrogen AM1354) and mMessage Machine T7 transcription kit (Invitrogen AM1344) according to manufacturer instructions. One-cell FVB/NRj zygotes were microinjected with 10 ng/µL each sgRNA and 25 ng/µL Cas9 mRNA to generate mouse founders. Deletions were validated by PCR and Sanger sequencing. The sgRNA target sequences are the following: RE(int) guide 1 (GGGAAATCGCCTTACCTTTC), guide 2 (GGACTGTTGGGTCACCTTGT), and RE(down) guide 1 (GGCTCCTTCGTCAGTAAATA), guide 2 (AAACAAGGGCTCTCTGGCGTTT). The deleted coordinates are the following in mm10: RE(int) chr5:119,874,013–119,880,148, and RE(down) chr5:119,891,017–119,915,744. Founders were backcrossed with wildtype FVB/NJ mice to obtain stable lines. Downstream experiments were performed on F3-F7 mice, backcrossed with wild-type FVB mice. All transgenic mice were maintained on a FVB/NJ background commercially obtained from Jackson laboratory (stock number 100800).
For tissue harvest, animals were euthanized by 20% CO₂ inhalation followed by cervical dislocation.

Bosada F.M., van Duijvenboden K., Giovou A.E., Rivaud M.R., Uhm J.S., Verkerk A.O., Boukens B.J, & Christoffels V.M. (2023). An atrial fibrillation-associated regulatory region modulates cardiac Tbx5 levels and arrhythmia susceptibility. eLife, 12, e80317.

+ Open protocol

+ Expand

In Vitro Production of sgRNA for CRISPR Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

To prepare sgRNAs for in tube cleavage assay, a double-stranded DNA template was generated by annealing two single-stranded oligonucleotides with complementary sequences (forward: 5′-AATTTAATACGACTCACTATAGGXXXXXXXXXXXXXXXXXXXXGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT-3′, reverse: 5′-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACXXXXXXXXXXXXXXXXXXXXCCTATAGTGAGTCGTATTAAATT-3′) at 95 °C for 5 min and 55 °C for 10 min. ‘X’s can be replaced with the spacer sequences for each sgRNA. The DNA was purified using QIAquick (Qiagen) columns, and the purified DNAs were then used as templates for a T7 in vitro transcription (IVT) reaction according to manufacturer’s direction (MEGAshortscript T7, Invitrogen, Carlsbad, CA, USA). In vitro transcribed sgRNAs were DNase treated, precipitated using the ammonium acetate/ethanol method, and then resuspended in distilled water for use with the SpyCas9 and its chimeric fusion proteins.

Park J., Yoon J., Kwon D., Han M.J., Choi S., Park S., Lee J., Lee K., Lee J., Lee S., Kang K.S, & Choe S. (2021). Enhanced genome editing efficiency of CRISPR PLUS: Cas9 chimeric fusion proteins. Scientific Reports, 11, 16199.

+ Open protocol

+ Expand

Generating Guide RNA Templates for CRISPR

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR amplified sgRNA template sequences were obtained using a plasmid donor along with forward primers containing T7 promoter, the desired guide target sequence, and an invariant sequence and a universal reverse primer (Supplementary Table 2). The sgRNA template amplicons were then purified by gel extraction (Qiagen) following manufacturer’s guidelines. In vitro transcription of sgRNA was then carried out following the MEGAshortscript T7 (Invitrogen) transcription protocol. TRIzol (Invitrogen) extraction of sgRNA was then carried out following manufacturer’s guidelines, except that 1 ml of TRIzol was added per 80 μl of T7 transcription product. The top sgRNA containing aqueous phase was then transferred to a fresh tube and sgRNA was precipitated using isopropanol, pelleted, and washed with 75% ethanol. The RNA pellet was then air dried in a culture hood followed by resuspension and concentrated in RNase free water. Aliquots were then frozen and stored at −80 °C.

Evans B.C., Fletcher R.B., Kilchrist K.V., Dailing E.A., Mukalel A.J., Colazo J.M., Oliver M., Cheung-Flynn J., Brophy C.M., Tierney J.W., Isenberg J.S., Hankenson K.D., Ghimire K., Lander C., Gersbach C.A, & Duvall C.L. (2019). An anionic, endosome-escaping polymer to potentiate intracellular delivery of cationic peptides, biomacromolecules, and nanoparticles. Nature Communications, 10, 5012.

+ Open protocol

+ Expand

Synthesis of Cas9 mRNA and sgRNAs

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

For synthesis of Cas9 mRNA in vitro, plasmid vector pCAG-T3-hCAS-pA (Addgene 48625) was linearized by Sph I, then transcribed with T3 RNA polymerase (Promega) in the presence of Ribo m⁷G Cap Analog (promega) as previously described [31 (link)]. The MEGAshortscript T7 (Thermo Fisher Scientific AM1354) and MEGAclear (Thermo Fisher Scientific AM1908) kits were used for in vitro transcription of sgRNAs, while the CRISPR Design tool was used for creating sgRNAs [32 (link)]. All oligonucleotide sequences used for in vitro transcription are listed in Supplementary Table S4.

Watamura N., Kakiya N., Nilsson P., Tsubuki S., Kamano N., Takahashi M., Hashimoto S., Sasaguri H., Saito T, & Saido T.C. (2021). Somatostatin-evoked Aβ catabolism in the brain: Mechanistic involvement of α-endosulfine-KATP channel pathway. Molecular Psychiatry, 27(3), 1816-1828.

+ Open protocol

+ Expand

CRISPR-Cas9 Genome Editing in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Guide RNA (sgRNA) constructs were designed using the online tool ZiFiT Targeter. 22 (link) For sgRNA sequences, see Table I in the Data Supplement. Cas9 and sgRNA constructs were transcribed in vitro with the MEGAshortscript T7 (Thermo Fisher Scientific; AM1354) and mMESSAGE mMACHINE T7 Transcription (Thermo Fisher Scientific; AM1344M). sgRNAs (10 ng/µL per sgRNA) and Cas9 mRNA (25 ng/µL) were injected into the cytoplasm of 1-cell FVB/NRj zygotes to generate founder mouse lines. Lines were maintained on an FVB/NRj background (Janvier). Animal care and experiments were performed in accordance with the national and institutional guidelines. In all experiments, both male and female animals were used.

van Ouwerkerk A.F., Bosada F.M., Liu J., Zhang J., van Duijvenboden K., Chaffin M., Tucker N.R., Pijnappels D., Ellinor P.T., Barnett P., de Vries A.A.F, & Christoffels V.M. (2020). Identification of Functional Variant Enhancers Associated With Atrial Fibrillation. Circulation research, 127(2).

+ Open protocol

+ Expand

Efficient Generation of CRISPR Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Guide RNA (sgRNA) constructs were designed using the online tool ZiFiT Targeter^{77 (link)}. The sgRNA sequences are summarized in Supplementary Table 5. The Cas9^{78 (link)} and sgRNA constructs were in vitro transcribed using the MEGAshortscript T7 and mMessage mMachine T7 Transcription Kit (ThermoFisher Scientific). The sgRNAs (10 ng/µl per sgRNA) and Cas9 mRNA (25 ng/µl) were microinjected into the cytoplasm of FVB/NRj zygotes to generate founder mouse lines. Lines were maintained on an FVB/NRj background.

van Ouwerkerk A.F., Bosada F.M., van Duijvenboden K., Hill M.C., Montefiori L.E., Scholman K.T., Liu J., de Vries A.A., Boukens B.J., Ellinor P.T., Goumans M.J., Efimov I.R., Nobrega M.A., Barnett P., Martin J.F, & Christoffels V.M. (2019). Identification of atrial fibrillation associated genes and functional non-coding variants. Nature Communications, 10, 4755.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!