Topvision agarose

Manufactured by Thermo Fisher Scientific

Sourced in United States

TopVision Agarose is a laboratory product designed for the separation and purification of DNA and RNA molecules. It is a high-quality agarose gel matrix used in gel electrophoresis techniques.

Automatically generated - may contain errors

Lab products found in correlation

Toptaq master mix, by Qiagen (2 mentions) Imagequant 150, by GE Healthcare (2 mentions) Pcr buffer, by Promega (1 mentions) Mgcl2, by Promega (1 mentions) Dntps, by Promega (1 mentions) Generuler 1 kb dna ladder, by Thermo Fisher Scientific (1 mentions) Diamond nucleic acid dye, by Promega (1 mentions) Tween 20, by Promega (1 mentions) Generuler 100 bp dna ladder, by Thermo Fisher Scientific (1 mentions) Gel doc xr imaging system, by Bio-Rad (1 mentions) Peqgreen, by Avantor (1 mentions) Phusion high fidelity dna polymerase, by Thermo Fisher Scientific (1 mentions) Page purified oligonucleotide primers, by Merck Group (1 mentions) Genelute plasmid miniprep kit, by Thermo Fisher Scientific (1 mentions) Dreamtaq pcr master mix, by Thermo Fisher Scientific (1 mentions) Zymoclean gel dna recovery kit, by Zymo Research (1 mentions) Rna isolation kit, by Qiagen (1 mentions) Faststart high fidelity pcr system, by Roche (1 mentions) Chemidoc touch imaging system, by Bio-Rad (1 mentions) Transcriptor high fidelity cdna synthesis kit, by Roche (1 mentions)

10 protocols using topvision agarose

Validation of Tbr Species Status

Check if the same lab product or an alternative is used in the 5 most similar protocols

We validated the isolates
Tbr species status using PCR as previously described.
^{13 (link)} DNA was prepared using QIAGEN DNAesy Blood & Tissue Extraction kit® Cat No 69504. Applied Biosystems Model 2720 thermocyclers was used and the reagents (Pcr Buffer, dNTPs, Mgcl
₂, a pair of primers (SRA A & E),Taq and pcr grade water were from Promega USA. The cycling conditions and reagent concentrations were according to Gibson et al 2002 except the reaction volumes were 10 microlitres per sample. We included DNA from a reference
Tbr as a positive control KETRI 3738
^{14 (link)} whereas PCR water and
Trypanosoma brucei brucei (
Tbb) were used as negative control. We resolved the amplicons on 2% molecular grade Top vision agarose (Thermo Scientific) stained with ethidium bromide, and documented the gel using UVITEC (Cambridge) gel imager.

Ndungu K., Thuita J., Murilla G., Kagira J., Auma J., Mireji P., Ngae G., Okumu P., Gitonga P., Guya S, & Mdachi R. (2023). The pathogenicity of blood stream and central nervous system forms of Trypanosoma brucei rhodesiense trypanosomes in laboratory mice: a comparative study. F1000Research, 11, 260.

+ Open protocol

+ Expand

Molecular Mechanisms of Linezolid Resistance

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mechanism of resistance to linezolid was determined by PCR (cfr, cfrB, oprA, and poxtA) and Sanger sequencing (23S rRNA, rplC, rplD, and rplV). DNA extraction was obtained from a fresh culture (24 hours) according to the manufacturer’s protocol (GenElute TM Bacterial Genomic DNA Kits, Sigma Aldrich, St. Louis, MO, USA). The list of enterococcal specific primers and settings of PCR used in the study are given in the Supplementary Table S2. PCR products of cfr, oprA were resolved in 1.5% agarose (TopVision Agarose, Thermo Scientific, St. Louis, MO, USA) in electrophoresis (5 V/cm) for 45 minutes. NCTC13923 was used as control strain for optrA detection in this study. The detection of cfr, poxtA, and cfrB was performed according to procedures as described previously [8 (link),12 (link),35 (link)]. The amplified fragments of the 23S rRNA, rplC, rplD, and rplV were sequenced by analyzer Applied Biosystems 3130xL. Point mutation/s associated with linezolid resistance were analyzed using software Bionumerics 7.6.2 (Applied Maths, Ghent, East Flanders, Belgium).

Mališová L., Jakubů V., Pomorská K., Musílek M, & Žemličková H. (2021). Spread of Linezolid-Resistant Enterococcus spp. in Human Clinical Isolates in the Czech Republic. Antibiotics, 10(2), 219.

+ Open protocol

+ Expand

Magnetic Nanoparticles for Molecular Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

The water used in the preparation of all solutions was ultra-pure. When not disclosed, reagents are from Fischer Scientific. A TRIS-EDTA (TE) buffer was prepared by combining TRIS, ethylenediaminetetraacetic acid (EDTA), and K₂HPO₄ at 10 mM, 1 mM, and 100 mM concentration, respectively. pH was adjusted to 7.4 using 1 M HCl. A TRIS-borate-EDTA (TBE) buffer 10x was acquired from FRILABO (Porto, Portugal). Phosphate buffer (PB) 0.1 M, pH 7.2 was prepared from stock solutions of Na₂HPO₄ and NaH₂PO₄ at 0.2 M. PB-Tween20 consisted on PB buffer with 0.02% (v/v) of Tween^® 20 from Promega (Madison, WI, USA).
The customized single stranded oligonucleotide sequences were synthesized by STABVIDA (Caparica, Portugal).
DNA-free water, MasterMix 16S Basic, and Moltaq 16S from Molzym (Germany) were used for PCR reactions. Electrophoresis reagents included TopVision agarose from Thermo Fisher Scientific^TM (MA, USA), for gel preparation, GRS DNA loading buffer blue 6x from GRiSP (Porto, Portugal), GeneRuler 1 kb DNA ladder from Thermo Fisher Scientific^TM, and Diamond^TM nucleic acid dye from Promega.
The MNPs were nanomag^®-D from Micromod (Rostock, Germany), with a diameter of 250 nm and 75–80% (w/w) magnetite in a matrix of dextran (40 kDa), streptavidin coated. The particles have a magnetic moment of ∼1.6 × 10⁻¹⁶ Am² for a 1.2 kA/m magnetizing field and a susceptibility of χ ∼ 4.

Viveiros S., Rodrigues M., Albuquerque D., Martins S.A., Cardoso S, & Martins V.C. (2020). Multiple Bacteria Identification in the Point-of-Care: an Old Method Serving a New Approach. Sensors (Basel, Switzerland), 20(12), 3351.

+ Open protocol

+ Expand

Amplification of toxR Gene by PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primers specific to toxR gene were purchased from SGP Biodynamics (Sofia, Bulgaria) (Table 1). The reaction mixture for PCR had volume of 25 μl and contained 2 μl of the extracted DNA, 12.5 μl TopTaq Master Mix (QIAGEN, Germany), 0.2 μl of each primer and 10.1 μl of water free from nucleases. Polymerase chain reaction took place in thermocycler QB-96 (Quanta Biotech, USA) with the following programme: i) initial denaturation at 94°C for 5 min, followed by 30 cycles of ii) denaturation at 94°C for 1 min., iii) annealing at 63°C for 2 min., iv) extension at 72°C for 1.5 min., v) final extension at 72°C for 10 min. The separation of the amplified DNA fragments was done by horizontal electrophoresis in 2% agarose gel TopVision Agarose (Thermo Scientific, USA) at 100 V for 1.30 hours. The gel was stained with safe dye peqGREEN (VWR International, Belgium) and visualized and documented with UV Transilluminator (ImageQuant 150, GE Healthcare). To determine molecular weight marker Gene Ruler 100 bp DNA Ladder (Thermo Scientific, USA) was used.

Stratev D., Stoyanchev T, & Bangieva D. (2021). Occurrence of Vibrio parahaemolyticus and Staphylococcus aureus in seafood. Italian Journal of Food Safety, 10(4), 10027.

+ Open protocol

+ Expand

Agarose Gel Electrophoresis for DNA Integrity

Check if the same lab product or an alternative is used in the 5 most similar protocols

The DNA integrity was analyzed by agarose gel electrophoresis using 1% and 2% agarose (TopVision Agarose, Thermo Fisher Scientific, Waltham, MA, USA) for gDNA and PCR amplicons, respectively. Agarose gel was stained with 1 μg/mL of ethidium bromide (EtBr). Electrophoresis was performed using Tris Acetate-EDTA (TAE) buffer and a constant voltage of 100 V for 50 min. The DNA bands were visualized, and images were acquired using a Gel Doc XR+ Imaging system (Bio-Rad Laboratories Inc., Hercules, CA, USA). A DNA sample is considered intact when its profile on agarose gel electrophoresis corresponds to a well-defined “line” of DNA [39 ]. The level of degradation of a sample is determined by the loss of definition of the predominant band and the accompaniment of a smear along the gel [40 ]. To assess the integrity of each sample in an objective and standardized way, a measurement scale has been defined for the different DNA profiles observed after the electrophoretic run, as presented in Table S3.

Alemán-Duarte M.I., Aguilar-Uscanga B.R., García-Robles G., Ramírez-Salazar F.D., Benítez-García I., Balcázar-López E, & Solís-Pacheco J.R. (2023). Improvement and Validation of a Genomic DNA Extraction Method for Human Breastmilk. Methods and Protocols, 6(2), 34.

+ Open protocol

+ Expand

Molecular Detection of Staphylococcus spp. and S. aureus

Check if the same lab product or an alternative is used in the 5 most similar protocols

Primers specific to 16S rRNA gene of Staphylococcus spp. and nuc gene of S. aureus were purchased from Eurofins Genomics (Germany) (Table 2). The reaction mixture for PCR had volume of 25 μl and contained 1 μl of the extracted DNA, 12.5 μl TopTaq Master Mix (QIAGEN, Germany), 0.2 μl of each primer (Eurofins Genomics, Germany) and 11.1 μl water free of nucleases. The polymerase chain reaction was performed in a thermocycler QB-96 (Quanta Biotech, USA) with the following programme: i) initial denaturation at 94°C for 5 min. followed by 30 cycles of ii) denaturation at 94°C for 1 min. iii) annealing at 55°C for 30 sec., iv) extension at 72°C for 1 min., v) final extension at 72°C for 7 min. The separation of the amplified DNA fragments was made by horizontal electrophoresis in 2% agarose gel TopVision Agarose (Thermo Scientific, USA) at 100 V for 1.30 hours. The gel was stained with peqGREEN (VWR International, Belgium) and visualized and documented with UV Transilluminator (ImageQuant 150, GE Healthcare). To determine the molecular weight Gene Ruler 100 bp DNA Ladder marker (Thermo Scientific, USA) was used.

Stratev D., Stoyanchev T, & Bangieva D. (2021). Occurrence of Vibrio parahaemolyticus and Staphylococcus aureus in seafood. Italian Journal of Food Safety, 10(4), 10027.

+ Open protocol

+ Expand

Preparation of Bacterial Growth Media

Check if the same lab product or an alternative is used in the 5 most similar protocols

LB: 10 g l⁻¹ tryptone, 5 g l⁻¹ yeast extract, 5 g l⁻¹ NaCl; LB agar: LB supplemented with 15 g l⁻¹ agar; BHI (brain heart infusion) (Oxoid): 37 g l⁻¹. All media were autoclaved for 30 min at 121 °C (1 atm). Ampicillin (0.1 g l⁻¹) and kanamycin (0.015 g l⁻¹) were used for selection. M9 medium was prepared as described previously²⁶ with slight modifications. The M9-agarose, 5 × M9 salts, glucose, and casamino acids stock solutions were prepared separately. Casamino acids solution was filter-sterilized, all other solutions were autoclaved for 30 min at 121 °C (1 atm). M9 agarose: 0.2 g l⁻¹ MgSO₄, 0.01 g l⁻¹ CaCl₂, 15 g l⁻¹ Thermo Scientific™ TopVision Agarose; 5 × M9 salts pH 7.4 stock solution: 35 g l⁻¹ Na₂HPO₄, 15 g l⁻¹ KH₂PO₄, 2.5 g l⁻¹ NaCl, 5 g l⁻¹ NH₄Cl; 20 g l⁻¹ glucose; 2 g l⁻¹ casamino acids. M9 medium was supplemented with 0.1 g l⁻¹ ampicillin, 0.015 g l⁻¹ kanamycin, 0.023 g l⁻¹ IPTG, 0.02 g l⁻¹ uracil, cytosine, and N⁴-acetylcytosine, as required.

Stanislauskienė R., Laurynėnas A., Rutkienė R., Aučynaitė A., Tauraitė D., Meškienė R., Urbelienė N., Kaupinis A., Valius M., Kaliniene L, & Meškys R. (2020). YqfB protein from Escherichia coli: an atypical amidohydrolase active towards N4-acylcytosine derivatives. Scientific Reports, 10, 788.

+ Open protocol

+ Expand

Plasmid Construction via PCR and Yeast Transformation

Check if the same lab product or an alternative is used in the 5 most similar protocols

To amplify DNA fragments for plasmid construction, Phusion® High-Fidelity DNA Polymerase (Thermo Scientific, Waltham, MA) was applied as specified in the manufacturer's protocol, using PAGE-purified oligonucleotide primers (Sigma-Aldrich). Diagnostic polymerase chain reaction (PCR) was performed with DreamTaq PCR Master Mix (Thermo Scientific), according to the manufacturer's protocol and with desalted oligonucleotide primers (Sigma-Aldrich). PCR-amplified linear integration cassettes were purified from 1% (w/v) agarose gels (TopVision Agarose, Thermo Fisher) with TAE buffer (50x, Thermo Fisher) using a Zymoclean Gel DNA Recovery Kit (Zymo Research, Irvine, CA). E. coli XL1-Blue competent cells were transformed by heat shock for 40 s at 42°C and, after 1 h recovery at 37°C in SOC medium, plated on selective LB ampicillin media. The GenElute Plasmid Miniprep kit (Thermo Fisher Scientific) was used to isolate plasmids from overnight cultures in 15 mL Greiner tubes on selective medium. S. cerevisiae was transformed with the lithium-acetate method (Gietz and Woods 2002 (link)). Transformants were selected on SMD agar with acetamide as sole nitrogen source. Single-cell lines of transformants were obtained by three consecutive re-streaks on solid selective medium.

Dekker W.J., Wiersma S.J., Bouwknegt J., Mooiman C, & Pronk J.T. (2019). Anaerobic growth of Saccharomyces cerevisiae CEN.PK113-7D does not depend on synthesis or supplementation of unsaturated fatty acids. FEMS Yeast Research, 19(6), foz060.

+ Open protocol

+ Expand

Identification of MITF Isoforms in GIST Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with a QIAGEN RNA Isolation Kit (QIAGEN USA) from all types of GIST cells and HMC-1 cells, which were used as a control. cDNA was generated by reverse transcription using the Transcriptor High Fidelity cDNA Synthesis Kit (ROCHE, CA. USA). RT-PCR was performed using the Fast start High Fidelity PCR System (ROCHE, CA. USA) to identify MITF isoforms A, C, H, CM, and M and was performed following instructions with slight modifications 17 .
HPRT F: TGACCTGATTTATTTTGCATACC, R: CGAGCAAGACGTTCAGTCCT, were used as a control. PCR products were separated by electrophoresis in 2 % agarose gel TopVision agarose (Thermo Waltham, MA USA). PCR products were detected by the transillumination UV ChemiDocTM Touch Imaging System (Bio-Rad Laboratories, Inc. USA).

Proaño-Pérez E., Serrano-Candelas E., García-Valverde A., Rosell J., Gómez-Peregrina D., Navinés-Ferrer A., Guerrero M., Serrano C, & Martín M. (2023). The microphthalmia-associated transcription factor is involved in gastrointestinal stromal tumor growth. Cancer gene therapy, 30(2).

+ Open protocol

+ Expand

Genotyping of TNF-alpha 308G>A Polymorphism

Check if the same lab product or an alternative is used in the 5 most similar protocols

For all the surveyed cases, the following laboratory tests were carried out to determine the levels of cholesterol, LDL cholesterol, aspartate aminotransferase (ASAT), alanine aminotransferase (ALAT), and glycemia (Gly). The cholesterol and LDL-chol levels were measured by spectrophotometry on a Cobas Integra 400 Plus automated analyzer and were considered normal at levels <170 mg/dl; the percentiles for age and gender were also reported according to the standard table values. 17 2.3.3. Genotyping description Rapid isolation of total DNA was done from 100 ml of fresh blood samples by using the Quick-gDNA MiniPrep kit (ZymoResearch) according to the manufacturer's instructions.
TNF-a 308G>A polymorphism genotyping was carried out by using the amplification refractory mutation systemepolymerase chain reaction (ARMS-PCR) assay with primers (Eurogentec) previously described by Daneshmandi et al. 18 but with modifications to the PCR protocol.
The PCR consisted of an initial denaturation of 7 min at 95 C, followed by 35 cycles at 94 C for 30s, at 57 C for 30s, and at 72 C for 40s, with a final extension of 7 min at 72 C. The PCR products were separated by applying 2% agarose gel electrophoresis (TopVision Agarose; Thermo Scientific) with ethidium bromide staining.

Mărginean C.O., Mărginean C., Iancu M., Moldovan V.G., Melit L.E, & Bănescu C. (2019). The impact of TNF-α 308G>A gene polymorphism on children's overweight risk and an assessment of biochemical variables: A cross-sectional single-center experience. Pediatrics and neonatology, 60(1).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!