Anti ha ab9110
Anti-HA (ab9110) is a mouse monoclonal antibody that recognizes the HA tag. The antibody is designed for the detection of proteins tagged with the HA epitope.
Lab products found in correlation
5 protocols using anti ha ab9110
Antibody Panel for Cellular Signaling
ChIP Protocol for Transgenic Plants
Immunoblotting Protocol with Diverse Antibodies
Targeted siRNA knockdown of epigenetic regulators
5′-CAGCTGGCAGAATTTACTAAA-3′), SET7/9 (5′-
TAGGGCCAGGGTATTATTATA-3′) or LSD1/AOF2 (3′-
CTGGAAATGACTATGATTTAA) was purchased from Qiagen (Valencia, CA, USA). Anti-YY2K247me1 and anti-YY2K247pan antibodies were generated by GenScript, Inc (Piscataway, NJ, USA). Antigen (peptide sequence) used for generating anti-YY2K247me1 and anti-YY2 K247pan was CTKVKPKRSK(me1)GEPPK; anti-Flag (F1804) antibody was purchased from Sigma; anti-SET7/9 (07–314) was purchased from Upstate (Billerica, MA, USA); anti-LSD1/AOF2 (A300-215A) was purchased from Bethyl Laboratory Inc. (Montgomery, TX, USA); anti-HA (ab9110) used for ChIP-seq was purchased from Abcam (Cambridge, MA, USA); anti-GAPDH (sc-25778) and anti-ACTIN (SC-8432) were purchased from Santa Cruz Biotechnology (Santa cruz, CA, USA). Peptide sequences were as follows: YY2 K247: CTKVKPKRSKGEPPK; YY2K247me1: CTKVKPKRSK(me1)GEPPK; YY2 K139: TSTQSRSKKPSKKPS.
Antibodies Used in Protein Research
Anti-Orb2 and anti-Mrj antibodies were raised against recombinant 6X Histidine-tagged full-length protein, in rabbit and guinea pig for Orb2 and guinea pig for Mrj. For immunoprecipitation, protein-A agarose beads (Repligen 102500–03) and RFP trap magnetic beads (Chromo Tech rtma) were used.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!