HeLa, U2OS, and 293T cells were cultured in Dulbecco’s Modified Eagles Medium supplemented with 10% fetal bovine serum following standard culture conditions and procedures. Human SDE2 and CDT2 cDNA were acquired from Open Biosystems (MHS1010-97228092) and the Dana-Farber/Harvard Cancer Center DNA Resource Core (HsCD00330875), respectively. The full-length or deleted cDNA was PCR-amplified and subcloned into pcDNA3-Flag, pcDNA3-HA (Invitrogen), pEGFP-C1/N1 (Clontech), and pGEX6P-1 (GE Healthcare Life Sciences). Point mutations were introduced using the QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) and confirmed by DNA sequencing. Stable cell lines were generated by retroviral transduction of pMSCV-SDE2-Flag constructs, followed by selection in the presence of 2 μg/mL puromycin.
Pegfp c1 n1
Manufactured by Takara Bio
PEGFP-C1/N1 is a plasmid vector that contains the enhanced green fluorescent protein (EGFP) gene. It is designed for the expression of EGFP fusion proteins in mammalian cells. The vector includes a cytomegalovirus (CMV) promoter for high-level expression of the EGFP fusion protein, as well as a multiple cloning site for the insertion of the gene of interest.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using pegfp c1 n1
1
Generation and Characterization of SDE2 and CDT2 Cell Lines
2
Cloning and Sequencing of Dlc1 Isoforms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The full length Dlc1 isoforms, namely isoform 1 (GenBank: HM008381.1), isoform 2 (GenBank: AF178078.1) and isoform 3 (GenBank: AK147539.1) were amplified using different isoform specific PCR primers as follows: isoform 1-cDNA- F, 5′ATGTCTGTAGCTATCAGAAAGAGGAGCTGGGAAG; isoform 2-cDNA- F, 5′CTGCGCCGACCTTAATGTGTAG; isoform 3-cDNA-F, 5′GGTGGATGGGGGACCCCGAGGGC and isoform 1/2/3-cDNA-R, 5′GTTGCAGTCACGGGTGCTTC. The amplified cDNAs were subsequently cloned in the both pEGFP-C1/N1 (Clontech, Mountain View, CA) and pHTN/C HaloTag (Promega, Madison, WI) plasmids. The plasmids containing full-length Dlc1 isoforms were sequenced to verify the lack of any PCR induced mutations and compared with the Genbank sequence.
3
Plasmid Expression of Protein Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Protein constructs were expressed with a CMV promoter using pEGFP-C1/N1 (Clontech) (enhanced GFP, referred to here as GFP) or pcDNA3.1 (Invitrogen) vector backbones (Table S2). Plasmids expressing sgRNAs with 2xPP7 loops targeting lacO/tetO repeats were designed as gBlocks (Integrated DNA Technology) and cloned into a U6 promoter-driven sgRNA expression vector (Table S3). Plasmids expressing mutated sgRNAs were derived from the wildtype plasmids by site-directed mutagenesis with primers containing the single nucleotide replacement.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!