Primescript reverse transcript reagent kit

Total RNA was isolated from the frozen adipose tissues by column method (Bio Basic, Canada) and according to the manufacturer’s instruction RNA quality was determined by measuring the 260/280 nm ratio. Moreover, the concentration was determined by an ultraviolet spectrophotometer (PCR^maxLambada, Japan). Complementary DNA synthesis was performed with 500 ng RNA from each sample using PrimeScript Reverse Transcript Reagent Kit (TaKaRa Inc., Japan). Quantitative real-time polymerase chain reaction (qRT-PCR) analysis was carried out to quantify the expression of omentin (as a target gene), compared with Beta 2 Microglobulin (B2M) (as a reference gene) using SYBR Premix Ex Taq П (TaKaRa Inc., Japan) by Rotor-Gene 6000 qPCR machine (Qiagen, Germany). The specific primers for omentin and B2M were F-5′-GCTGAAGAGAACCTGGAC-3′ and R-5′-AATAGAGACCATCTTGTGC-3′, F-5′-CTTCAGCAAGGACTGGTC-3′ and F-5′-TCTCGATCCCAGTAGACG-3′, respectively. The stages of tree steps qPCR were pre-denaturation at 95 °C for 5 min, frothy cycles at 95 °C for 10 s, 55 °C (for omentin) and 57 °C (for B2M) for 20 s, as well as 62 °C for 30 s. Melting curve analysis was performed by increasing the temperature (1 °C) from 52 to 95 °C with continues fluorescence acquisition. Relative expression in omentin mRNA levels was calculated using the 2^−ΔΔCT method and normalized based on B2M mRNA levels.

Briefly, total RNA was extracted using the TRIzol reagent (Invitrogen) and complementary DNA was generated using the PrimeScript™ reverse transcript reagent Kit (Takara, Tokyo, Japan). From 1 μg RNA aliquots, we synthesized cDNA using random hexamers or oligo (dT), and reverse transcriptase, following the manufacturer’s protocol. The reactions were run for 40 cycles at 30°C for 10 mins, 42°C for 20 mins, 99°C for 5 mins, and 4°C for 5 mins using real-time PCR detection system (Bio-Rad, Hercules, USA) according to the manufacturer’s instruction and verified on gel. Real-time reverse transcriptase-polymerase chain reactions (real-time RT-PCRs) were performed using the Power SYBR Green PCR Master Mix (Roche) and a 7500 real-time PCR detection system (Applied Biosystems). Actin was used as an internal control. Primer sequences are listed in Table 2. All experiments were performed in triplicate, and the data are shown as mean ± SD.

RNA extractions from cells and frozen muscle tissues were performed using a column method according to the manufacturer’s instruction (Bio basic, Canada). The total RNA quality and concentrations were determined by measuring the 260/280 nm ratio using a bio-spectrophotometer (Lambda max, Japan). Complementary DNA (cDNA) was synthesized using PrimeScript Reverse Transcript Reagent Kit (Takara, Japan). The quantitative SYBR green (Takara, Japan) real-time polymerase chain reaction (qRT-PCR) was done in duplicate reactions (Rotor-Gene 6000, Qiagen, Germany) to assess the SNCA mRNA expression. All the primer sequences are mentioned in Table 1. Thermal profile was a 95 °C for 5 min followed by 40 cycles at 95 °C for 10 s, 60 °C for 20 s, and 62 °C for 30 s. Melting curve analysis was also performed by increasing the temperature (1 °C) from 57 °C to 95 °C with continues fluorescence acquisition. Relative expressions of SNCA mRNA levels were calculated using the 2^−ΔΔCT method and normalized based on Beta 2 Microglobulin (B2M) mRNA levels.Table 1

Specific primers for real time- PCR assay

Primer sequence (5′ → 3′)	Target	PCR product (bp)
F: TGACAGCAGTCGCTCAGAAG R: TCATAGTCTTGGTAGCCTTCCTCTG	SNCA NM_001042451	190
F-5′-CTTCAGCAAGGACTGGTC-3′ R-5′-TCTCGATCCCAGTAGACG-3′	B2M NM_009735.3	129