The brain cortex of the ischemic side of each rat was separated and placed in an enzyme-free tube that had been prepared in advance. The RNA extraction Kit (Beyotime, Shanghai, China) was used to extract total RNA, wherein 20 μl of reverse transcription system was mixed with 1 μg of RNA template. The RNA samples were reverse-transcribed to cDNA in a machine at 50°C for 15 min and 85°C for 5 min. After the reaction, the samples were briefly centrifuged and cooled on ice. PCR was performed in a PCR machine. About 20 μl of amplification solution was mixed with 1 μl of cDNA and 10 μl of fluorescent dye. Samples then underwent the following protocol: denaturation at 95°C for 10 min and 40 cycles at 95°C for 15 s and 60°C for 60 s. The relative mRNA level of the gene was measured via 2−ΔΔCT method. GAPDH was used as the endogenous reference gene. HiFiScript cDNA Synthesis Kit and UltraSYBR Mixture were purchased from CWBIO (Taizhou, China). The primer sequences are listed in Table 1 .
Rna extraction kit
Manufactured by Beyotime
Sourced in China
The RNA extraction kit is a laboratory tool designed to isolate and purify ribonucleic acid (RNA) from various biological samples. It utilizes a combination of chemical and physical methods to effectively extract and concentrate RNA for further analysis and applications.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 2000, by Thermo Fisher Scientific (4 mentions)
Ultrasybr mixture, by CWBIO (2 mentions)
Tb green premix ex taq 2, by Takara Bio (2 mentions)
Hiscript 3 rt supermix for qpcr gdna wiper, by Vazyme (2 mentions)
Rst strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Light cycler 480ii pcr system, by Thermo Fisher Scientific (2 mentions)
Primescript rt master mix, by Takara Bio (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Ack lysing buffer, by Thermo Fisher Scientific (2 mentions)
Hifiscript cdna synthesis kit, by CWBIO (1 mentions)
Quantstudiotm 7 flex real time pcr system, by Thermo Fisher Scientific (1 mentions)
Q sybr green supermix, by Bio-Rad (1 mentions)
Cdna synthesis kit, by Beyotime (1 mentions)
Primescript rt pcr kit, by Takara Bio (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Cfx96 touch qpcr system, by Bio-Rad (1 mentions)
Revertaid master mix, by Thermo Fisher Scientific (1 mentions)
Primescripttm 2 1st strand cdna synthesis kit, by Takara Bio (1 mentions)
Uv spectrophotometer, by PerkinElmer (1 mentions)
Cdna reverse transcription kit, by Vazyme (1 mentions)
36 protocols using rna extraction kit
1
Quantification of Ischemic Brain mRNA
2
Angiogenesis Gene Expression in HUVECs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To evaluate the effect of the sTi/VEGF on angiogenesis genes (MMP-2, Bax and Bcl-2), HUVECs were cultured in 6-well plates (1 × 106/well) for 1 and 4 days with eTi, sTi and sTi/VEGF. Total cellular RNA was extracted with RNA extraction kit (Beyotime, Shanghai, China) and reversed transcribed to cDNA using cDNA synthesis kit (Beyotime, Shanghai, China) following the manufacturer’s instructions. The expression levels of mRNA were detected using Q SYBR green Supermix (Bio-Rad, Hercules CA, USA) and QuantStudioTM 7 Flex real-time PCR system (Applied Biosystems, Carlsbad, CA, USA). Finally, the relative gene expression levels were calculated using the comparative Ct method (2-△△Ct) and normalized based on the expression levels of the endogenous human GAPDH gene.
3
Gene Expression Analysis in Xenografts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Both total RNA from xenografts and cells were extracted by RNA Extraction Kit (Beyotime, China). Reverse transcription and qRT-PCR were performed according to Instruction of PrimeScript™ RT.
reagent Kit with gDNA Eraser for Perfect Real Time and TB Green™ Premix Ex Taq™ II (Takara, China), respectively. Primers for PLIN2: Forward TCA ACT CAG ATT GTT GCC AATG, Reverse TTT GGT GAG TGC ATT TTC TACG. Primers for ACSL3: Forward CGT GTC TTC AAA ACC ATC TACC, Reverse TCT TGT CTT GAC TCG GAG AAAA. Primers for ALOX15: Forward TCA CCT TCC TGC TCG CCT AGTG, Reverse GGT GCT GCT GGC TAC AGA GAATG. Primers for LC3A: Forward CCT GGA CAA GAC CAA GTT TTTG, Reverse GTA GAC CAT ATA GAG GAA GCCG. Primers for IPO7: Forward GGC ACA TCC GCA CCG TCT TC, Reverse CGG ACC GCA TTC AGA TCC TTC. Primers for PRDM11: Forward AAG AAC AAC CGC TAT AAG TCCA, Reverse GAG AAC TTG GGC TTC CTC TTAC. The whole process was implemented by Applied Biosystems 7500 (the USA).
reagent Kit with gDNA Eraser for Perfect Real Time and TB Green™ Premix Ex Taq™ II (Takara, China), respectively. Primers for PLIN2: Forward TCA ACT CAG ATT GTT GCC AATG, Reverse TTT GGT GAG TGC ATT TTC TACG. Primers for ACSL3: Forward CGT GTC TTC AAA ACC ATC TACC, Reverse TCT TGT CTT GAC TCG GAG AAAA. Primers for ALOX15: Forward TCA CCT TCC TGC TCG CCT AGTG, Reverse GGT GCT GCT GGC TAC AGA GAATG. Primers for LC3A: Forward CCT GGA CAA GAC CAA GTT TTTG, Reverse GTA GAC CAT ATA GAG GAA GCCG. Primers for IPO7: Forward GGC ACA TCC GCA CCG TCT TC, Reverse CGG ACC GCA TTC AGA TCC TTC. Primers for PRDM11: Forward AAG AAC AAC CGC TAT AAG TCCA, Reverse GAG AAC TTG GGC TTC CTC TTAC. The whole process was implemented by Applied Biosystems 7500 (the USA).
4
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
First, the total RNA from the RAW264.7 cells was extracted using the RNA extraction kit (R0032, Beyotime, China). Then a PrimeScript RT reagent kit (RR047A, TaKaRa, Japan) was used to reverse the RNA into cDNA. Quantitative real-time polymerase chain reaction (RT-PCR) was performed with the PrimeScript RT-PCR kit (RR820A, TaKaRa, Japan). The RT-PCR reaction proceeded at 95°C for 30 s, 95°C for 5 s and 60°C for 30 s for 40 cycles. Gene expression was calculated with the 2–△△Ct method. The primers used in this study are listed in Table 1 .
5
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with the RNA Extraction kit (Beyotime, Shanghai, China), and the concentrations were measured with the NanoDrop 2000 (Thermo Fisher Scientific, MA, USA). The cDNA was synthesized using the RevertAid Master Mix (Thermo Fisher Scientific). Real-time quantitative polymerase chain reaction (RT-qPCR; Platinum® qPCR SuperMix-UDG, Thermo Fisher Scientific) was performed by a CFX96 Touch qPCR System (Bio-Rad, CA, USA) as previously described [23 (link)], using specific sets of primers/probes for genes of interest (Supplementary Table 1 ). Gene expressions were assessed in relation to the levels of β-actin.
6
Quantifying HOXA-AS3 Expression in Colon Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Following extraction of total RNAs from colon cancer tissues and adjacent tissues (about 5 cm from the lesion) by an RNA extraction kit (Shanghai Beyotime Biotechnology Co., Ltd., China, R0011), the purity and concentration of total RNAs were detected by UV spectrophotometry. Then cDNA was obtained through reverse transcription using PrimeScriptTM II 1st strand cDNA synthesis kit (TaKaRa, Japan, 6210A) and stored in a refrigerator at −20°C. Next, the expression of long non-coding RNA HOXA-AS3 was determined by real-time quantitative PCR. Upstream primer for long non-coding RNA HOXA-AS3: 5’-GAAAGCTGCAACATGCTCCC-3’, downstream primer: 5’-TCCATGTCGTCCCAGTTGGT-3’ (synthesized by Sangon Biotech (Shanghai) Co., Ltd., China). GAPDH was used as an internal reference. The 2−∆∆CT method was used to calculate the relative expression of target gene.
7
Quantitative Analysis of Tight Junction Molecules
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from right lung tissue by using RNA extraction kit (Beyotime Biotech Co. Ltd., Shanghai, China), and its concentration and purity were measured by UV spectrophotometer (PerkinElmer, USA). cDNA was obtained by reverse transcription and stored at -20°C. The fragments of ZO-1, Claudin 5, Occludin, TLR4, p38 and NF-κB mRNA were amplified by real-time quantitative PCR (RT-qPCR). The sequences of the primers used in the study were shown in Supplementary Table S1
8
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from each cell using an RNA extraction kit (Beyotime Institute of Technology, Ltd., Shanghai, China) following the manufacturer’s protocol. Total RNA was extracted from primary and recurrent tumor specimens with TRIzol Reagent (Saiguo Biotechnology Co. Ltd., Guangzhou, China). The concentration of total RNA was measured using a NanoDrop2000 (Thermo Fisher) and the mRNA expression levels were determined via RT-qPCR using SYBR Green Master Mix (TsingKe Biological Technology Co., Ltd., Guangzhou, China). Results were normalized to the expression of U6. Primer sequences used in RT-qPCR are shown in Table 1 .
Primer Sequences Used for qPCR
| U6 | F: CTCGCTTCGGCAGCACA |
| GAPDH | F: GGTGTGAACCATGAGAAGTATGA |
| miR-602 | F: TCGGCAGGGACACGGGCGACAG |
| RASSF1A | F: GAAGTCATTGAGGCCCTGCT |
| JNK | F: CTGAAGCAGAAGCTCCACCA |
| c-Jun | F: GGAGATGAAGTGGGGTGCAA |
| ATF-2 | F: ATGGTAGCGGATTGGTTA |
9
Macrophage Polarization Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA was extracted using RNA Extraction Kit (Beyotime, Haimen, China) and transcribed with a cDNA Reverse Transcription kit (Vazyme, Nanjing, China). Quantitative polymerase reaction was performed using SYBR Green Mix (Vazyme, Nanjing, China). The RNA expressions were examined for the following factors: TNF-α (M1 macrophages markers), Arg-1 and CD206 (M2 macrophages markers). GAPDH was used as the internal reference and the primer sequences are listed in Supplementary Material (Table S1) .
10
Chondrocyte RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from chondrocytes using the RNA Extraction Kit (Beyotime) and stimulated with different concentrations of BMDC and TBHP (20 ng/mL). Reverse transcriptase was used to synthesize cDNA from 500 ng of total RNA. For quantitative RT‐PCR (qPCR), a SYBR master mix of x2 consisted of 5 μL, 0.2 μL primer, 2 μL ddH2O, and 2 μL diluted cDNA, and was used, resulting in a total reaction volume of 10 μL. This experiment was conducted using an ABI 7500 Real‐Time PCR Detection System (Applied Biosystems). Table 1 includes a list of the primers used for the detection of the target gene.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!