The DNA fragment purification kit (TaKaRa Biotechnology, Dalian, China) was used to purify PCR products, which were synthesized with the primers containing a T7 polymerase promoter sequence (Supplementary Table S1 ) and cDNA of G. molesta. The purified PCR products were used as templates and MEGAscript RNAi Kit (Ambion) was used to synthesize the dsRNA of EGFP, GmTrx2, and GmTrx-like1, according to the manufacturer’s instructions. The synthesized dsRNA products were purified by using MEGAclear columns (Ambion) and redissolved with diethyl pyrocarbonate-treated nuclease-free water. The purity and concentration of dsRNA were measured with ultraviolet spectrophotometry and gel electrophoresis. To determine the interference efficiency of GmTrx2 and GmTrx-like1, fifth instar larvae were injected with approximately 3 μg of dsRNA into proleg using capillary microsyringe. The larvae were injected with dsEGFP as a control. One replicate of the treatments injected with dsRNA of GmTrx2 or GmTrx-like1 contained 13 larvae, while the treatments injected with dsEGFP had 10 larvae. Three replicates were used for each treatment. All samples were collected at 24, 48, and 72 h and stored at −80°C for later detection of gene expression.
Megaclear column
Manufactured by Thermo Fisher Scientific
Sourced in United States
MEGAclear columns are laboratory equipment designed for the purification and concentration of nucleic acids, such as DNA and RNA. They utilize a silica-based membrane to selectively bind and purify the target molecules, while removing contaminants. The core function of these columns is to enable efficient and reliable nucleic acid purification for various applications in molecular biology and genomics research.
Automatically generated - may contain errors
Lab products found in correlation
Megascript rnai kit, by Thermo Fisher Scientific (7 mentions)
Biophotometer, by Eppendorf (4 mentions)
Mmessage mmachine t7 ultra kit, by Thermo Fisher Scientific (3 mentions)
Megashortscript t7 kit, by Thermo Fisher Scientific (2 mentions)
Type c57bl 6j mice, by Jackson ImmunoResearch (2 mentions)
X tremegene hp, by Roche (2 mentions)
Hiseq instrument, by Illumina (2 mentions)
Agilent hs dna chip, by Agilent Technologies (2 mentions)
Dnase treatment, by Thermo Fisher Scientific (2 mentions)
Microbexpress, by Thermo Fisher Scientific (2 mentions)
Absolute qpcr sybr green rox mix, by Thermo Fisher Scientific (2 mentions)
Rnaseh and e coli dna polymerase, by New England Biolabs (2 mentions)
Superscript 2 and random hexamers, by Thermo Fisher Scientific (2 mentions)
Dna fragment purification kit, by Takara Bio (1 mentions)
Megascript kit, by Thermo Fisher Scientific (1 mentions)
Digoxygenin utp, by Roche (1 mentions)
Fast red solution, by Roche (1 mentions)
Hiscribe t7 quick high yield rna synthesis kit, by New England Biolabs (1 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Kapa taq kit, by Roche (1 mentions)
17 protocols using megaclear column
1
RNAi Silencing of Thioredoxin Genes in Grapholita molesta
2
dsRNA Synthesis for RNAi Experiments
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
dsRNAs were synthesized using the MEGAscript® RNAi Kit (Ambion, Huntingdon, UK) according to the manufacturer’s instruction. T7 promoter sequences were tailed to each 5’ end of the DNA templates by PCR amplifications. Double-stranded enhanced green fluorescent protein (dsEGFP) was generated using pPigbacA3EGFP as the template. All the primer sequences are listed in Supplementary Table S1
3
Riboprobe Synthesis and In Situ Hybridization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Riboprobes were transcribed from linearised plasmids using the Megascript kit (Ambion) in the presence of Digoxygenin-UTP (Roche) as follows: Cora EST RE40241 (BDGP): antisense NotI/T3, sense XhoI/T7; CG3570 EST GH09390: antisense EcoRI/Sp6; GluRIIA full-length cDNA (gift from Stephan Sigrist) antisense XhoI/T3. Probes were purified on Megaclear columns (Ambion). Fillets dissected in Ringer׳s solution were permeabilised in PBS Tween 0.1%, pre-hybridised for 2 h at 55 °C and hybridised overnight in the presence of 4 µg of probe in standard hybridisation buffer (Hyb). Stringent washes were carried out for 5 h at 55 °C in Hyb. The samples were then stained with Alkaline Phosphatase (AP) coupled anti-Dig (1:200, Roche) and FITC coupled anti-HRP (1:250, Jackson Immunoresearch Laboratories) antibodies overnight. Fast Red solution (Roche) was used as an AP substrate for 1 h at room temperature.
4
TALEN-Mediated Generation of HER2V777L Transgenic Mice
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HER2V777L Tg were generated using TALEN-based genome editing. ROSA26 specific TALENs were designed using the ZiFit targeter.22 (link) The TALEN kit used for TALEN assembly was a gift from Keith Joung (Addgene kit # 1000000017; Addgene, Watertown, MA). DNA fragments encoding ROSA TALEN repeat arrays were cloned into plasmid pJDS71. ROSA TALENs plasmids were linearized for in vitro transcription with EcoRI and TALENs RNA was synthesized using the mMessage mMachine T7 Ultra kit (Ambion, Austin, TX) and purified with Megaclear columns (Ambion).
The cassette of interest was synthesized (Genscript, Piscataway, NJ) and introduced into the mouse genome via pronuclear injection of in vitro transcribed TALENs RNA and ROSA donor DNA. Founders with correctly targeting mutant alleles are identified using long PCR with ROSA specific oligos outside of the homology arms. Founders were bred to WT to generate heterozygous F1 offspring. Analysis of F1 offspring via long PCR confirms germline transmission of the correctly targeted allele. Primers for genotyping heterozygous offspring are the following:
ROSA-green-WT-F1: 5′ GTT ATC AGT AAG GGA GCT GCA GTG GAG TAG 3′
ROSA-green-WT-R1: 5′ CCG AAA ATC TGT GGG AAG TCT TGT CCC TCC 3′
CAG-R2: 5′ CTC CAC CCA TTG ACG TCA ATG GAA AGT CCC 3′
The cassette of interest was synthesized (Genscript, Piscataway, NJ) and introduced into the mouse genome via pronuclear injection of in vitro transcribed TALENs RNA and ROSA donor DNA. Founders with correctly targeting mutant alleles are identified using long PCR with ROSA specific oligos outside of the homology arms. Founders were bred to WT to generate heterozygous F1 offspring. Analysis of F1 offspring via long PCR confirms germline transmission of the correctly targeted allele. Primers for genotyping heterozygous offspring are the following:
ROSA-green-WT-F1: 5′ GTT ATC AGT AAG GGA GCT GCA GTG GAG TAG 3′
ROSA-green-WT-R1: 5′ CCG AAA ATC TGT GGG AAG TCT TGT CCC TCC 3′
CAG-R2: 5′ CTC CAC CCA TTG ACG TCA ATG GAA AGT CCC 3′
5
Generation of Slc12a8 Knockout Mouse Model
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Whole-body Slc12a8 knockout (Slc12a8KO) mice were generated with the CRISPR-CAS9 technology by the Transgenic Vectors Core of Washington University. CRISPR gRNAs were designed to flank exon 4 of the Slc12a8 gene. gRNA sequences were as follows: 5’ gRNA; 5’- agtgcatgtatagacgtatg - 3’ and 3’ gRNA; 5’ - cctcacaaatatttacaggc - 3’. gRNAs were obtained as gBlocks (IDT). Cleavage activity was assessed by transfecting N2A cells with gBlock and Cas9 plasmid (addgene # 42230) using XtremegeneHP (Roche). Cleavage activity was determined by T7E1 assay using standard methods. gRNA was in vitro transcribed using the T7 Megashort Script Kit (Ambion). Cas9 RNA was in vitro transcribed using the mMessage mMachine T7 Ultra Kit (Ambion). All RNA was purified using Megaclear Columns (Ambion). RNA was microinjected into C57BL/6J × CBA hybrid zygotes at a concentration of 50 ng/μl Cas9, 25 ng/μl gRNA, and 100 ng/μl ssODN in the Washington University Mouse Genetic Core Facility. Whole-body knockout alleles were detected by PCR across the cleavage site and confirmed by sequencing. One heterozygous founder was established, and the mice were backcrossed to wild-type C57BL/6J mice (Jackson Laboratories) for 5 generations before analysis. Slc12a8-deficient heterozygous mice were crossed to generate homozygous Slc12a8KO mice. Wild-type littermates were used as controls.
6
RNAi Knockdown of AGO2 in Glossina pallidipes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate dsRNA to knockdown AGO2, total DNA was isolated from G. pallidipes using the Qiagen DNeasy Blood and Tissue kit (QIAGEN Inc., Valencia, CA). The extracted DNA was subsequently used to produce T7 tailed PCR amplicons of AGO2 using primers designed to contain 5′-T7 promotor sequences (See Table 2 ). These primers allowed dsRNAs transcription using the Hiscribe T7 Quick high yield RNA synthesis kit (New England Biolabs, UK) according to the manufacturer’s instructions. Template DNA was removed from the transcription reaction by DNase treatment, as described in the transcription kit. The synthesized dsRNAs were purified using MEGAclear columns (Ambion, ThermoFisher Scientific, USA) and eluted in 50 μl nuclease free water. The tsetse EP gene, an immune response gene with extensive glutamic acid-proline dipeptide repeats, that has been successfully knocked down in tsetse, [45 (link), 46 (link)] was used to assess the efficiency of the knockdown treatment (i.e. by measuring the expression of the tsetse EP gene).
7
Microbial Community DNA and mRNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methods for microbial community DNA and mRNA sequencing were as previously described 44 (link),45 (link). Fecal pellets collected from mice before or after LPS treatment (pooled from 2 and 3 days post-injection) were kept at −80°C until DNA and RNA isolation using the guanidinium thiocyanate/cesium chloride gradient method 46 (link) as described, except that crude particles were removed by centrifugation prior to overlaying the gradient. RNA was subjected to DNase treatment (Ambion), purification using MEGAClear columns (Ambion), and rRNA depletion via subtractive hybridization (MICROBExpress, Ambion, in addition to custom depletion oligos). The presence of genomic DNA contamination was assessed by PCR with universal 16S rDNA primers. cDNA was synthesized using SuperScript II and random hexamers (Invitrogen, Carlsbad, CA), followed by second strand synthesis with RNaseH and E.coli DNA polymerase (New England Biolabs). Samples were prepared for sequencing with an Illumina HiSeq instrument after enzymatic fragmentation (NEBE6040L/M0348S). Libraries were quantified by quantitative PCR (qPCR) according to the Illumina protocol. qPCR assays were run using ABsoluteTM QPCR SYBR Green ROX Mix (Thermo Scientific) on an Mx3000P QPCR System instrument (Stratagene, La Jolla, CA). The size distribution of each library was quantified on an Agilent HS-DNA chip (Agilent, Santa Clara, CA).
8
Generation of Slc12a8 Knockout Mouse Model
9
Synthesis and Validation of dsRNA for RNAi
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The synthesis of dsRNA was carried out using the MEGAscript RNAi kit (Ambion) following the manufacturer’s instructions. dsRNA templates were obtained by PCR with gene-specific primers containing T7 polymerase sites, as previously described26 (link)27 (link)28 (link). The primer sets are shown in Table S1 . PCR amplification was carried out according to the following conditions: 94 °C for 4 min, 35 cycles of 94 °C for 1 min, 60 °C for 1 min and 72 °C for 1 min, and a final elongation at 72 °C for 10 min. The PCR product was further purified and used as a template for in vitro dsRNA synthesis. The obtained dsRNA was initially treated with DNase and RNase to remove the template DNA and single-stranded RNA, respectively. The dsRNA was then purified using MEGAclear™ columns (Ambion) and eluted with diethyl pyrocarbonate-treated nuclease-free water. The quality of dsRNA was determined using a biophotometer (Eppendorf). The dsRNA of enhanced green fluorescent protein (EGFP) was used as a negative control.
The effects of RNAi on mRNA expression were analyzed by qPCR. The corresponding primers are shown inTable S1 .
The effects of RNAi on mRNA expression were analyzed by qPCR. The corresponding primers are shown in
10
Microbial Community DNA and mRNA Sequencing
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!