Opti mem

Cas9 protein, crRNAs and tracrRNAs were purchased from Integrated DNA Technologies (Coralville, IA, USA). Two crRNAs were designed to target the Hr gene in eight inbred strains (5′-CTAACACTTGGCATGACCAA-3′ and 5′-GATGGAAGCCCCTGGCTAGA-3′). The RNP complex was prepared in Opti-MEM (Thermo Fisher Scientific, Waltham, MA, USA) with 2.4 μM Cas9 protein, 3.7 μM crRNA and 7.4 μM tracrRNA at 25°C for 5 min. RNP solutions were prepared immediately before electroporation and kept on ice until use.
Electroporation was performed using the TAKE method (Kaneko, 2017 (link)) with a NEPA21 Super Electroporator (NEPA GENE Co. Ltd, Chiba, Japan). The poring pulse was set to a voltage of 40 V, pulse length of 3.0 ms, pulse interval of 50 ms, number of four pulses, decay rate of 10% and + polarity. The transfer pulse was set to a voltage of 10 V, pulse length of 50 ms, pulse interval of 50 ms, number of five pulses, decay rate of 40% and +/− polarity. A 1-mm gap electrode (CUY501P1-1.5, NEPA GENE) was filled with 5 μl RNP solution, and zygotes washed with Opti-MEM solution were arranged on the electrode. Electroporated zygotes were observed for survival and cultured in KSOM overnight at 37°C and 5% CO₂.

The plasmids and mRNA transposases for transgenesis were dissolved in OPTI-MEM (Thermo Fisher Scientific, Inc.). The embryos were transferred to M2 medium containing 0.1 M sucrose (Nacalai Tesque). The plasmids and mRNA were injected into the perivitelline space of embryos using an injection pipette with a spike (TPC, Målov, Denmark), followed by electroporation of the embryos in OPTI-MEM (S2 Table) using a Super Electroporator NEPA21 Type II (NEPA GENE, Chiba, Japan) and platinum plate electrodes on a glass slide (1 mm gap, L 15 mm× W 1 mm × H 1.5 mm). The embryos were incubated in M2 medium for 10 min at room temperature. For common marmosets, embryos were cultured in sequential blast medium for 7–14 days. After cultivation, the embryos were used for subsequent experiments.

MII oocytes were collected as described above. The RNP complex was co-injected with sperm during ICSI^{38 (link)}. MII oocytes and sperm were washed in a drop of 200 ng/µl RNP complex in opti-MEM (Invitrogen), and ICSI was performed in the drop. Electroporation of the RNP complex into ICSI embryos was performed using a Super Electroporator NEPA21 (Nepa Gene). In brief, 10 min after ICSI, zygotes were placed in the glass chamber between 1-mm-gap platinum electrodes (Nepa Gene); this chamber was filled with 6 µl of opti-MEM containing 200 ng/µl RNP complex^{39 (link)}. The poring pulse parameters were as follows: voltage, 40 V; pulse width, 3.5 ms; pulse interval, 50 ms; and number of pulses, +4. The transfer pulse parameters were as follows: voltage, 5 V; pulse width, 50 ms; pulse interval, 50 ms; and number of pulses, ±5.

The wild-type cyiPSC line 1123C1 was previously described.^{20 (link)} cyiPSCs were maintained in AK-02N medium (Ajinomoto).
CRISPR-Cas9 constructs were designed based on a previous report.^{21 (link)} To inactivate B2M, we aimed at disrupting exon 2 of the cynomolgus monkey B2M gene. The guide RNA sequence was UAUGUUCCUCAGGUACUCCA, which corresponds to the sequence at the 5′-end of exon 2 (Fig. 1A). The guide oligo DNAs (Table 1) corresponding to the guide RNA sequence were annealed and ligated to pSpCas9(BB)-2A-Puro.^{21 (link)}BbsI was then used to digest pSpCas9(BB)-2A-Puro. DNA vectors (3.3 μg) encoding the guide RNA for B2M and Cas9 were introduced into 1.0 × 10⁶ cyiPSCs in 100 μL OPTI-MEM by a nucleofection system following the manufacturer's instructions (Nepa21, Nepa Gene). Electric pulses (175 V, 5 ms) were used. Two days after the nucleofection, the cells were cultured with puromycin. Eight days after the nucleofection, 39 colonies were picked up, and the cells in each colony were expanded. Genomic DNAs were extracted from the cells and subjected to polymerase chain reaction (PCR) analysis.