Rt2 sybrgreen quantitative pcr mastermix

RNA was isolated using Trizol^® (Invitrogen Life Technologies, Carlsbad, CA, USA) with the Direct-zol™ RNA MiniPrep kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s instructions. Real-time PCR was then performed using primers, as described previously [58 (link)]. Quantitative RT-PCR analysis was performed using RT2 SYBRgreen quantitative PCR mastermix (Qiagen) in the Applied Biosystems 7500 real-time RT-PCR system (Life Technologies, Grand Island, NY, USA). Primers for Nrf2 were F: 5′-GGTTGGCCCTTTCCTGCTTT-3′ and R: 5′-TCCATGTCCCTTGACAGCACA-3′; primers for HO-1 were F: 5′-AACTTTCAGAAGGGCCAGGT-3′ and R: 5′-CTGGGCTCTCCTTGTTGC-3′; primers for ABCC1 were F: 5′-GTGGCTATCAAGGGCTCCGT-3′ and R: 5′-CCCACTGGGCAGGATTTCCA-3′; primers for ABCG2 were F: 5′-AGATGGGTTTCCAAGCGTTCAT-3′ and R: 5′-CCAGTCCCAGTACGACTGTGACA-3′; primers for NQO1 were F: 5′-TGAAGGACCCTGCGAACTTTC-3′, and R: 5′-GAACACTCGCTCAAACCAGC-3′. Relative abundance of target mRNA was determined from Ct values and normalized to the geometric mean of the housekeeping gene GAPDH.

RNA was isolated using Trizol^® (Invitrogen Life Technologies, Carlsbad, CA, USA) with the Direct-zol™ RNA MiniPrep kit (Zymo Research, Irvine, CA, USA) according the manufacturer’s instructions. qRT-PCR was then performed using primers as described [41 (link)]. Quantitative RT-PCR analysis was performed using RT² SYBRgreen quantitative PCR mastermix (Qiagen, Montréal, PQ, Canada) in the Applied Biosystems 7500 real-time RT-PCR system (Life Technologies, Grand Island, NY, USA). The relative abundance of target mRNA was determined from cycle threshold values (Ct) and normalized to the geometric mean of the housekeeping gene cyclophilin A.

mRNA expression of SIRT-1 was measured in the aorta of young and old mice by quantitative PCR. Briefly, RNA isolated from aortic tissue was used to synthesize cDNA via QuantiTect Reverse Transcription kit (Qiagen, Inc., Valencia, CA, USA). Quantitative PCR was performed using RT² SYBR^® Green quantitative PCR Mastermix (Qiagen, Inc.). Fold change in mRNA expression was calculated as the fold difference in expression of target mRNA to 18s rRNA $2^{-(\text{target}{\text{C}}_{\text{T}}-18\text{s}{\text{C}}_{\text{T}})}$ and normalized to young values. 18s primer sequences: forward: TAGAGGGACAAGTGGCGTTC; reverse: CGCTGAGCCAGTCAGTGT. SIRT-1 primer sequences: forward: GATTGGCACAGATCCTCGAA; reverse: GTCTACAGCAAGGCGAGCATA. SOD1 primer sequences: forward: AACCAGTTGTGTTGTCAGGAC; reverse: CCACCATGTTTCTTAGAGTGAGG. SOD2 primer sequences: forward: CAGACCTGCCTACGACTATGG; reverse: CTCGGTGGCGTTGAGATTGTT. SOD3 primer sequences: forward: CCTTCTTGTTCTACGGCTTGC; reverse: TCGCCTATCTTCTCAACCAGG.