Anti eppk1 antibody or mouse igg

The chromatin immunoprecipitation assay was performed using the HeLa cells following the protocol provided by Abcam (Cambridge, MA, USA). The diluted DNA-protein complex was incubated with an equal amount of anti-Eppk1 antibody or mouse IgG (Santa Cruz) overnight at 4℃ in the presence of herring sperm DNA and protein A/G beads. Chromosomal DNA was puri ed and analyzed by RT-qPCR. The PCR primers for the Eppk1 gene promoter to amplify the KLF5-binding region were as follows:
Forward: 5'TGGGGCCTGGTGGGGGGAAAG 3'; Reverse: 5'GGCCGGCCCCCTCTGACTCA 3'.There were three groups of samples: IgG (negative control), Input (positive control) and Ad-KLF5.
Cell proliferation assay CCK-8 assay was used to detect the growth and proliferation of Hela cells. Hela vaccination in 96-well plates, 100 μl per hole cell suspension, after waiting for cell adherent to group training, each group have 3 hole, cultivate 12 h, 24 h, 48 h, 72 h, 96 h after 10 μl per hole to join CCK 8 solution, set a zero cell free hole, incubator to 4h incubation, enzyme standard instrument determination at 450nm OD value.

To perform the chromatin immunoprecipitation test using the HeLa cells following the protocol provided by Abcam (Cambridge, MA, USA). To hatch the diluted DNA-protein complex with an equal amount of anti-Eppk1 antibody or mouse IgG (Santa Cruz) overnight at 4℃ in the presence of herring sperm DNA and protein A/G beads. To purify Chromosomal DNA and examined by RT-qPCR. The PCR primers for the Eppk1 gene promoter to expand the KLF5-binding region was as follows: Forward: 5'TGGGGCCTGGTGGGGGGAAAG 3'; Reverse: 5'GGCCGGCCCCCTCTGACTCA 3'.To divide the samples into three groups: IgG (negative control), Input (positive control) and Ad-KLF5.