Sybr green qrt pcr kit

Manufactured by Merck Group

Sourced in United States

The SYBR green qRT-PCR kit is a laboratory equipment product designed for quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analysis. The kit includes the necessary reagents and components to perform real-time gene expression analysis. The SYBR green dye used in the kit binds to double-stranded DNA, allowing for the detection and quantification of targeted gene sequences.

Automatically generated - may contain errors

Lab products found in correlation

Rneasy mini kit, by Qiagen (1 mentions) Qiaamp viral rna mini kit, by Qiagen (1 mentions)

Spelling variants of this product

SYBR Green (192 citations) SYBR Green kit (11 citations) QRT-PCR kit (10 citations) QRT-PCR (2 citations)

2 protocols using sybr green qrt pcr kit

Quantification of EV-A71 RNA in RD Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the EV-A71-infected and gemcitabine-treated RD cells at 3 hpi and 6 hpi using RNeasy mini kit (Qiagen, #74106). DMSO (0.1%) was used as treatment control. The relative abundance of viral RNA was detected using MD90/MD91 primers and SYBR green qRT-PCR kit (Sigma, #QR0100). Human β-actin was used as a loading control. Primers used for qRT-PCR in this assay are listed in Table 1.Table 1

Primers used for EV-A71 RNA quantification.

Name	Sequence
MD90	ATTGTCACCATAAGCAGCCA
MD91	CCTCCGGCCCCTGAATGCGGCTAAT
β-actin-F	AGAGCTACGAGCTGCCTGAC
β-actin-R	AGCACTGTGTTGGCGTACAG

Sun J., Yogarajah T., Lee R.C., Kaur P., Inoue M., Tan Y.W, & Chu J.J. (2020). Drug repurposing of pyrimidine analogs as potent antiviral compounds against human enterovirus A71 infection with potential clinical applications. Scientific Reports, 10, 8159.

+ Open protocol

+ Expand

Quantifying Avian Influenza Virus Shedding

Check if the same lab product or an alternative is used in the 5 most similar protocols

To assess virus shedding, the tracheal and cloacal swabs were inoculated into 9–11 days SPF embryonated eggs. After 3 dpi, RNA in the allantoic fluids was extracted using a QIAamp Viral RNA Mini Kit (Qiagen, USA). A one-step quantitative RT–PCR (qRT-PCR) using an SYBR® Green qRT-PCR kit (Sigma-Aldrich, USA) was carried out using one pair of primers specific for the matrix gene of AIVs (primer sequences available upon request). The cycle threshold (Ct) values of the strains to be tested were evaluated by the standard curve constructed.

Sun Y., Cong Y., Yu H., Ding Z, & Cong Y. (2021). Assessing the effects of a two-amino acid flexibility in the Hemagglutinin 220-loop receptor-binding domain on the fitness of Influenza A(H9N2) viruses. Emerging Microbes & Infections, 10(1), 822-832.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!