Ab124943

The primers of RAC3 (F: TCCCCACCGTTTTTGACAACT; R: GCACGAACATTCTCGAAGGAG), GAPDH (F: CTGGGCTACACTGAGCACC; R: AAGTGGTCGTTGAGGGCAATG) were designed using the primer 5.0. Total RNAs were extracted using an RNA Extraction Kit (Nuoweizan Biotechnology, Nanjing, China), and were reversely transcribed into cDNA using PrimeScript RT Master Mix (Takara, Shiga, Japan). The RNA expression levels of RAC3 were quantified using the 2^–ΔΔCT (Livak) method.
Western blotting was performed as previously described. Proteins were extracted from harvested BCa cells separately and quantified by BCA assay. The primary antibodies used in this study were recombinant anti-RAC3 antibody (1:1000, ab124943, Abcam) and anti-GAPDH antibody (1:5000, ab181602, Abcam) in our study.

Fresh frozen tissue samples were homogenized in lysis buffer (Solarbio, Beijing, China) and quantified with an Easy Protein Quantitative Kit (TransGen Biotech, Beijing, China). Fifty micrograms of total protein lysate was loaded in each lane. Proteins were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to PVDF membranes (Biosharp, Guangzhou, China). The PVDF membranes were incubated with anti-Rac3 (1:1,000; ab124943, Abcam, Cambridge, United Kingdom) and anti-GAPDH (1:2,000; Bioss, Beijing, China) antibodies overnight at 4°C. Then, the membranes were incubated with the secondary antibodies horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (1:2,000; ab205718, Abcam, United States) and goat anti-mouse IgG (1:2,000; ab205719, Abcam, United States) at room temperature for 1.5 h. The membranes were visualized using an EasySee® Western Blot Kit (TransGen Biotech). The experiment was performed three separate times, and two parallel samples were ran in each experiment.