Rotor gene q real time instrument

We evaluated the change of telomere length during passaging using real-time quantitative RT-PCR (RT-qPCR)^{8 (link)}. Telomere-specific primers (forward: 5′-CGGTTTGTTTGGGTTTGGGTTTGGGTTTGG GTTTGGGTT-3′; reverse:5′-GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT-3′) and the 36b4 primers (forward: 5′-CAGCAAGTGGGAAGGTGTAATCC-3′; reverse: 5′-CCCATTCTATCATCA ACGGGTACAA-3′ were used. All PCRs were performed on the Rotor-Gene Q real-time instrument (QIAGEN). Thermal cycling profile for both amplicons began with at 95 °C incubation for 10 min. For telomere PCR, there followed 25 cycles of 95 °C for 15 s, 58 °C for 1 min. For 36B4 PCR, there followed 30 cycles of 95 °C for 15 s, 58 °C for 1 min. Rotor-Gene Q software 2.0.2 was then used to determine the telomere-to-Single copy gene (T/S) ratio, which is demonstrated to be proportional to the average telomere length in a cell.

To evaluate the shortening telomere during passaging, MSC telomere length was measured with a qPCR-based technique that compares telomere repeat sequence copy number to single-copy gene (36B4) copy number according to a previous study^{14 (link),25 (link)}. The telomere-specific primers (forward: 5′GGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT3′; reverse: 5′GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT3′) and the 36b4 primers (forward: 5′CAGCAAGTGGGAAGGTGTAATCC3′; reverse: 5′CCCATTCTATCATCAACGGGTACAA3′ were prepared. All PCRs were performed on the Rotor-Gene Q real-time instrument (QIAGEN, Hilden, Germany). The thermal cycling profile for both amplicons began with 95 °C incubation for 10 min. For telomere PCR, there followed 25 cycles of 95 °C for 15 s, 58 °C for 1 min. For 36B4 PCR, there followed 30 cycles of 95 °C for 15 s, 58 °C for 1 min. Rotor-Gene Q software 2.0.2 was then used to generate the standard curve for each plate and to determine the dilution factors of standards corresponding to the T and S amounts in each sample. Relative T/S ratios will reflect relative length differences in telomeric DNA.

RNA isolation from peritoneal wall and fat graft samples was performed applying TRI Reagent (MRC Inc.) according to the manufacturer’s protocol. After isolation, RNA was converted to cDNA using cDNA mix (Quanta Biosciences) according to the manufacturer’s protocol. Quantitative real-time PCR was performed with Rotor-Gene Q real-time instrument (Qiagen, Hilden, Germany) with primers for GAPDH, IL-10, TGF-b1, IL-1b, TNF-a, IL-2, IL-4, IL-12b, IL-13, and IL-17a. See Supplementary Material and Table S1 for protocol and primers. RT-qPCR results were obtained by the ΔΔCt method^{16 (link)} using GAPDH as a housekeeping gene; the median values are used. Statistical significances were determined from ΔCt values.