Irdye 800 dye

Protein was extracted from the calvarial cultures using RIPA Buffer (Fisher Scientific, # PI89901) according to the manufacturer’s instructions. Proteins were then resolved in 4–20% or 4–15% Mini-PROTEAN TGX gels (BIORAD, Cat# 4561093 and Cat# 4561083). Proteins were transferred onto TransblotTurbo Midi-size nitrocellulose membranes (0.2 μm pore size, BIORAD, Cat# 1704271). The membranes were blocked for 30 min with LICOR Blocking Buffer-PBS (LICOR, Cat# 4561083) and incubated overnight with primary antibodies and rocking at 4 °C. The primary antibodies used were LAMP2A (Novus Biologicals, # NBP267298), LC3 (Cell Signaling Technology, # 12741), β-Actin (Millipore Sigma, A5316), Ubiquitin (Cell Signaling Technology, #43124), K48-Ubiquitin (Cell Signaling Technology, #8081). After overnight incubation, membranes were washed three times with PBS and incubated for 45 min with appropriate secondary antibodies conjugated with IRDye 680 or IRDye 800 dyes (LI-COR). After washing with PBS, membranes were dried in the dark, scanned, and analyzed with an Odyssey IR imaging system (LI-COR) and Image Studio Software.

SDS–PAGE and WB were performed as described previously12 (link). Blots were incubated with primary rabbit polyclonal antibodies and mouse monoclonal antibodies, followed by incubation with appropriate secondary antibodies conjugated with IRDye 680 or IRDye 800 dyes (LI-COR). Blots were scanned and analyzed with an Odyssey IR imaging system (LI-COR).

For the identification of induced point mutation in HSBP1, a TILLING platform based on Red Setter cultivar was used [46 (link)]. DNA amplification was performed using nested PCR with gene-specific primers (HSBP1-For-ext: GGCCCTTTAAAGAACTCTCTCTG, HSBP1-Rev-ext: ATAGGCGGGTGTAGGGTTCT, HSBP1-For-int: TTGGTTCAATTTTCATGCACTT, HSBP1-Rev-int: AAAAAGGCTATAAATTTTCTATTATTGC. Internal primers were 5’-end labeled with IRDye 700 and IRDye 800 dye (LI-COR, Lincoln, NE, USA), respectively. The PCR amplifications were carried out according to the experimental conditions described previously [47 (link)]. Mutation detection was performed by using Endonuclease ENDO I [48 (link)] and LI-COR 4300 DNA Analyzer (LI-COR, Lincoln, NE, USA). Adobe Photoshop software was used for image analysis (Adobe Systems Inc., San Jose, CA, USA). Mutation was validated by Sanger sequencing, and its position was defined at nt 761 from the first nucleotide of the amplicon generated by primers HSBP1-For-ext/HSBP1-Rev-ext. Prediction of the impact of amino acid change on protein function was done using SIFT software [49 (link)].

The search for induced point mutations in the SlLCY-E gene (Solyc12g008980.1) was done in the Red Setter TILLING platform [21 (link)] according to the experimental conditions described in Dalmais et al. [23 (link)]. The Red Setter SlLCY-E mRNA sequence, deposited in Genbank database (https://www.ncbi.nlm.nih.gov/, accessed on 27 April 2020) under the accession number EU533951.1, was used to retrieve the SlLCY-E gene structure information in the SGN website (https://solgenomics.net/, accessed on 27 April 2020) and the genomic sequence then used for primer design. Two couples of SlLCY-E gene-specific primers were selected and employed in the molecular screening based on nested-PCR (Table 1).
The first PCR was conducted with the external primers (Fw-ext/Rev-ext) and the second PCR with the internal forward (Fw-int) and reverse (Rev-int) primers 5′-end labelled with IRDye 700 and IRDye 800 dye (LI-COR^®, Lincoln, NE, USA), respectively.
The detection of mutations was performed with the mismatch specific endonuclease ENDO I [24 (link)] and the LI-COR 4300 DNA analyzer (LI-COR^®, Lincoln, NE, USA). The information on the identity and nucleotide change position in the screened region was obtained via Sanger sequence analysis.

Protein samples were resolved by SDS-gel electrophoresis on 8% acrylamide gels and either stained with Coomassie blue or transferred to Immobilon FL membranes (Millipore, Bedford, MA). The concentration of purified P4-ATPases (ATP11A, ATP11B, and ATP1C) was determined on Coomassie blue stained SDS gels using bovine serum albumin as a standard. For western blotting, membranes were blocked with 1% milk in PBS for 30 min and subsequently incubated with the primary antibody in blocking buffer for 1 h. After three washes in phosphate buffered saline (PBS) containing 0.05% Tween 20 (PBST), the membranes were incubated with a secondary goat anti-rabbit or goat anti-mouse Ig antibody conjugated with IRDye 800 dye (Li-Cor Biosciences) diluted 1:20,000 in blocking buffer for 30 min and subsequently washed with PBST three times. The primary antibodies used for western blots were diluted as follows: ATP11C-11E3 and Cdc50-7F4 hybridoma cell culture fluid diluted 1:10 in PBS; Rho1D4 hybridoma cell culture fluid diluted 1:100; ATP11A and ATP8A1 were diluted as recommended by the manufacturers. Labeled membranes were visualized on an Odyssey Infrared Imaging System (LI-COR Biosciences).