Stellar escherichia coli cells

For cDNA library construction, saffron corms growing in the field were transferred during one week to growth chambers simulating field conditions (12 h light/dark cycles at 22°C/10°C). 24 h before the collection of the material, the light in one chamber was constant and in the other chamber the samples were incubated under no light. Flowers were dissected and red stigmas were used in the experiment. Total RNA was isolated from dark (control) and light-treated red stigmas using the RNeasy Plant Mini Kit (Qiagen, Germany). For PCR-select cDNA subtraction, mRNAs were purified with the Oligotex^™ mRNA Mini Kit (Qiagen, Germany). The suppression subtractive hybridization (SSH) cDNA libraries, forward (light-treated) and reverse (dark control), were prepared using a PCR-Select cDNA Subtraction Kit (Clontech, California, USA) and following the manufacturer’s instructions. Two rounds of hybridization and PCR amplification were performed to normalize and enrich differentially expressed cDNA. The subtracted cDNA was further cloned into the pGEM-T easy vector (Promega, Madison, WI, USA) and transformed into chemically competent Stellar Escherichia coli cells (Clontech, Takara, Japan). The transformed cells were selected on LB agar plates containing ampicillin (100 μg/mL) at 37°C o/n for screening.

M. mulieris (strain BV 64-5) genomic material was purchased from ATCC (ATCC 35240D5) and the putative adhesin sequence was PCR-amplified using E14 forward (5′-tattttcagggcgccAAGCCTGGAGTGGGCACCTACGCTAC-3′) and I30 reverse (5′-gaattccggatccattcaGTAGCTAAACGAGTTTTCTGCGGTTACTTCGACATTC-3′) primers with 5′ 15-base-pair complementary pProEX HTa vector sequences for In-Fusion cloning (Clontech) (Table 1 ▸). A high annealing temperature of 72°C was chosen to minimize false priming due to the GC-rich sequence of the M. mulieris genome. The vector was similarly PCR-amplified with pProEX HTa Fwd (ATGGATCCGGAATTCAAAGGCCTAC) and pProEX HTa Rev (GGCGCCCTGAAAATACAGGTTTTC) primers to produce a linear product that was circularized with the adhesin gene fragment by In-Fusion recombination cloning and transformed into electrocompetent Stellar Escherichia coli cells (Clontech). A single colony was transferred into a 12 ml culture tube containing 5 ml 2×YT medium supplemented to 0.1 µg ml⁻¹ ampicillin and incubated with shaking at 37°C overnight. The plasmid was extracted and purified from a 1 ml volume of cells using a Nucleospin Plasmid EasyPure kit (Macherey-Nagel).

M. mulieris (strain BV 64-5) genomic material was purchased from ATCC (ATCC 35240D5) and the putative adhesin sequence was PCR-amplified using E14 forward (5′-tattttcagggcgccAAGCCTGGAGTGGGCACCTACGCTAC-3′) and I30 reverse (5′-gaattccggatccattcaGTAGCTAAACGAGTTTTCTGCGGTTACTTCGACATTC-3′) primers with 5′ 15-base-pair complementary pProEX HTa vector sequences for In-Fusion cloning (Clontech) (Table 1 ▸). A high annealing temperature of 72°C was chosen to minimize false priming due to the GC-rich sequence of the M. mulieris genome. The vector was similarly PCR-amplified with pProEX HTa Fwd (ATGGATCCGGAATTCAAAGGCCTAC) and pProEX HTa Rev (GGCGCCCTGAAAATACAGGTTTTC) primers to produce a linear product that was circularized with the adhesin gene fragment by In-Fusion recombination cloning and transformed into electrocompetent Stellar Escherichia coli cells (Clontech). A single colony was transferred into a 12 ml culture tube containing 5 ml 2×YT medium supplemented to 0.1 µg ml⁻¹ ampicillin and incubated with shaking at 37°C overnight. The plasmid was extracted and purified from a 1 ml volume of cells using a Nucleospin Plasmid EasyPure kit (Macherey-Nagel).