Complete nuclear rDNA ITS region (ITS1 + 5.8S + ITS2), part (1361–1419 bp) of the large rRNA subunit (LSU) coding region, partial (505–636 bp) sequence of the glyceraldehyde phosphate dehydrogenase encoding gene (gapdh), and a ca. 1097 bp region of the 140 kDa size subunit of the nuclear RNA polymerase II encoding gene (rpb2) were PCR amplified by using genomic DNA as template. The complete ITS region was amplified with ITS1 and ITS4 primers [70 ], the 5′ region of the LSU with 5.8sr and LR7 primers [71 (link)], and the partial rpb2 region with 7cf and 11bR primers [72 (link)]. Primers were designed to amplify the partial gapdh region from Phlebia isolates (fw: 5′-ATG GTC TAC ATG TTC AAG TAC GAC-3′; rev: 5′-TCG ACG AGG GGA TGA TGT T -3′). PCR reactions were conducted with Dynazyme II or Phusion Hot Start DNA polymerase (Finnzymes, Finland). PCR was performed as previously described [27 (link), 73 (link)].
Dynazyme 2
Manufactured by Thermo Fisher Scientific
Sourced in Finland
The DyNazyme II is a thermostable DNA polymerase enzyme used for PCR amplification. It is a modified version of the original DyNazyme enzyme, designed to provide improved performance and reliability in DNA amplification applications.
Automatically generated - may contain errors
Lab products found in correlation
Phusion hot start dna polymerase, by Thermo Fisher Scientific (1 mentions)
Rneasy mini kit, by Qiagen (1 mentions)
Dynamo cdna synthesis kit, by Thermo Fisher Scientific (1 mentions)
Mastercycler, by Eppendorf (1 mentions)
Dntp mix, by GE Healthcare (1 mentions)
Proteinase k, by Thermo Fisher Scientific (1 mentions)
5 protocols using dynazyme 2
1
Amplification of Fungal Genomic Regions
2
RNA Extraction and cDNA Synthesis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were trypsinized and total cellular RNA was isolated from the precipitate by using the RNeasy mini kit (Qiagen, Germany) according to the manufacturer's protocol, with additional DNase treatment. The cDNAs were synthesized from the total RNA samples with the DyNAmo cDNA synthesis kit (Finnzymes, Finland) according to the manufacturer's protocol. cDNA amplification for flt3 and gapdh was performed by using DyNAzyme II (Finnzymes) with the following primers: human FLT3: Forward 5'GGAAGAAGAGGAGGACTTA3' , Reverse 5' AGGTCTCTGTGAACACACGA3'; human GAPDH: Forward 5'GGCTGAGAACGGGAAGCTTGTCAT3'; Reverse 5'CAGCCTTCTCCATGGTGGTGAAGA3' . The initial denaturation step was at 95 °C for 5 min, followed by 30 cycles for flt3 and 23 cycles for gapdh of denaturation for 30 s at 94 °C, annealing for 30 s at 60 °C, followed by extension for 30 s at 72 °C. A final extension at 72 °C for 5 min was applied to all reactions.
3
Multiplex PCR Genotyping of AOX and Rosa26
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Crude DNA for genotyping was extracted from ear punches or tail cuts by standard methods (proteinase K treatment, isopropanol precipitation and overnight resuspension in TE at 56°C). Multiplex PCR genotyping was carried out using primers Aox 317 s: 5′-GCGATGCAAGATGGAGGGTA-3′ plus Aox 317 as: 5′-TGAATCCAACCGTGGTCTCG-3′ for AOX, and Rosa26_wt s: 5′-GACCTCCATCGCGCACTCCG-3′ plus Rosa26_wt as: 5′-CTCCGAGGCGGATCACAAGC-3′ for the wild-type Rosa26 locus, giving respective products of 317 and 523 bp. PCR reactions of 20 μl contained 4 pmol of each primer, DMSO at 2% and 0.2 μl DyNazyme II (Thermo Fisher Scientific), with cycle parameters of initial denaturation at 95°C for 5 min, then 39 cycles of denaturation at 95°C for 20 s, annealing at 56°C for 30 s and extension at 72°C for 60 s, with final extension step at 72°C for 10 min, followed by 1.5% agarose gel electrophoresis. See Fig. S1D for example gel.
4
Repetitive Element Palindromic PCR Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Repetitive element palindromic (rep-PCR) using the (GTG)5 primer (5´-GTG GTG GTG GTG GTG-3´) was performed [20 (link)] with a few modifications. Briefly, 1 μL of DNA was pipetted into 24 μL of a PCR mixture containing 1 µL of the (GTG)5 primer (50 pmol/µL), 0.5 μL of dNTP mix (10 nmol/µL of each dNTP; GE Healthcare), 0.5 µL of DNA polymerase (2 U/µL; Dynazyme II; Thermo Scientific), 2.5 μL of 10× PCR buffer (100 nmol/µL Tris-HCl, 15 nmol/µL MgCl2, 150 nmol/µL KCl, 0.1% Triton X-100; pH 8.8, Thermo Scientific), and 19.5 µL sterile distilled water. The cycling program of the Eppendorf Mastercycler (Eppendorf, AG) consisted of an initial denaturation step at 94 °C for 7 min, 30 cycles of denaturation at 90 °C for 30 sec, annealing at 40 °C for 1 min, extension at 65 °C for 8 min and a final extension at 65 °C for 16 min. Obtained PCR products were separated on a 2% agarose gel and stained with GelRed Nucleic Acid Gel Stain.
The cluster analysis of the rep-PCR profiles was performed on similarity matrices, which were produced using the Dice’s coefficient [21 (link)] and subjected to the unweighted pair group method with arithmetic mean (UPGMA) clustering algorithm using the BioNumerics software version 7.6.1 (Applied-Maths, Saint-Martens-Latem, Belgium). A tolerance level of 1% and an optimization of 0.5% were chosen for creating the dendrogram.
The cluster analysis of the rep-PCR profiles was performed on similarity matrices, which were produced using the Dice’s coefficient [21 (link)] and subjected to the unweighted pair group method with arithmetic mean (UPGMA) clustering algorithm using the BioNumerics software version 7.6.1 (Applied-Maths, Saint-Martens-Latem, Belgium). A tolerance level of 1% and an optimization of 0.5% were chosen for creating the dendrogram.
5
Genomic DNA Isolation and Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from pieces of ear or tail after digestion at 55 C for 6 heovernight in 0.2 mg/ml Proteinase K (Thermo Fisher Scientific), 100 mM TriseHCl, pH 8.5, 5 mM EDTA, 0.2% SDS, 200 mM NaCl. DNA was precipitated in 50% isopropanol and dissolved in sterile water. For genotyping, fragments of knockout (primers F3 and R3) and WT (primers F4 and R4) alleles and for gender, a fragment of male specific Sry were amplified using DyNAzyme II (Thermo) DNA polymerase (Fig. 1, Supplementary Table I) 17 (link) .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!