Bm purple ap substrate precipitation

In situ hybridization of PFA-fixed limb specimens was performed in whole mount or 100-μm vibratome sections. The samples were treated with 10 μg/ml of proteinase K for 20–30 min at 20 °C. Hybridization with digoxigenin-labeled antisense RNA probes was performed at 68 °C. Alkaline phosphatase-conjugated antidigoxigenin antibody (dilution 1:2000) was used (Roche). Reactions were developed with BM Purple AP Substrate precipitation (Roche).
The probes for Uhrf1 and Uhrf2 were obtained by PCR from RNA extracted from chick or mouse limb buds at initial stages of digit formation. Specific primers for chick Uhrf1 were: 5′-tccacatctattgcctcaacc-3′ and 5′-gaacaccagattcgctcacc-3′; for chick Uhrf2 5′-agagttcaggtgagcgaagc-3′ and 5′-aggctcaacgtcatctctcc-3 and for mouse Uhrf1: 5′-tgactctggctatggtgtgg-3′ and 5′-gcctgatgttgccgtatagc-3′; and for mouse Uhrf2 5′-agagttcaggtgagcgaagc-3′ and 5′-tcgttcgattccttctgagg-3′.
The distribution of proliferating cells in the autopod was analyzed in paraffin-embedded tissue sections by detection of bromodeoxyuridine (BrdU) incorporation 60 min after injection into the amniotic sac of 100 μl of BrdU solution (100 mg/ml).

Hdac1, Hdac2, Hdac3, Hdac8, and Hdac10 RNA probes were obtained by PCR from chick limb buds at initial stages of digit formation. Specific primers for chick Hdac1 were 5′-ttcaccacgctaagaagtcg-3′ and 5′-cacgttgcggatcgtatagc-3′; for chick Hdac2, 5′-ttgccattgctgatgttagg-3′ and 5′-ttcaccactgttgtccttgg-3′; for chick Hdac3: 5′-gtgtttccagggctctttga-3′ and 5′-acccagagaatctgcaccac-3′; for chick Hdac8, 5′-ggcatcacgcaaagaaagat-3′ and 5′-tcctcccaggatgagagttg-3′; and for chick Hdac10: 5′-aacaacagctgagttggaagc-3′ and 5′-ccgtgttcggaatgatatgc-3′.
In situ hybridization of PFA-fixed limbs samples was performed in whole mounted or 150 µm vibratome sections. After proteinase K (10 µg/mL) treatments for 20–30 min at 20 °C, hybridization with digoxigenin-labeled antisense RNA probes was performed at 68 °C and alkaline phosphatase-conjugated anti-digoxigenin antibody (1:2000; Roche). Reactions were developed with BM purple AP substrate precipitation (Roche).

In situ hybridization of PFA-fixed limb specimens was performed in whole mount or 100 μm vibratome sections. The samples were treated with 10 μg/ml of proteinase K for 20–30 min at 20 °C. Hybridization with digoxigenin-labeled antisense RNA probes was performed at 68 °C. Alkaline phosphatase-conjugated anti-digoxigenin antibody (dilution 1:2000) was used (Roche). Reactions were developed with BM Purple AP Substrate precipitation (Roche).
The probes for Dnmt1, Dnmt3a, and Dnmt3b were obtained by PCR from RNA extracted from chick limb buds at initial stages of digit formation. Specific primers for chick were the following: Dnmt1, Fwd: GAGGACTGCAACGTTCTGC Rev: TGCTGACGAACTTCTTGTCG; Dnmt3a, Fwd: GAGAGAGGCGGAGAAGAAGG Rev: TGTCAGTCTCGTCGTTCTCG; Dnmt3b, Fwd: ACGAAGATGGCTACCAGTCC; Rev: TCTTGGTGATGTTCCTGACG