Hot firepol evagreen qpcr mix plus no rox

One hundred nanograms of cDNA was added to PCR Master Mix (Thermo Fisher Scientific, Waltham, MA, USA, #K0172), with forward and reverse primers (Table S6), and run on a Biometra T3000 Thermal Cycler (Westburg BV, Utrecht, The Netherlands) using an initial denaturation step at 95 °C for 3 min, followed by 30 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 1.5 min and a final extension at 72 °C for 7 min. PCR products were analyzed on a 3% agarose gel and band intensity was quantified using ImageJ software version 1.51 (Rasband, W.S., ImageJ, NIH, Bethesda, MD, USA, RRID:SCR_003070). Expression values were normalized to β-actin expression and calculated relative to siNT. Real-time PCR was performed on a LightCycler 480 (Roche) using the HOT FIREPol^® EvaGreen^® qPCR Mix Plus (no ROX) (Solis BioDyne, Tartu, Estonia, #08-25-00001). Primers were designed using Primer-BLAST 3.0 (RRID:SCR_003095) and purchased as custom oligonucleotides from Invitrogen (Table S6). Expression levels were determined on the basis of the threshold cycle calculated by the LightCycler 480 software (RRID:SCR_012155) and normalized to β-actin. Relative expression levels were calculated compared to siNT (2^−ΔΔCt).

RT-qPCR assays were performed for 15 target genes. Primer sequences designed for each gene are shown in S1 Table. All real-time reactions were performed in a Rotor-Gene Q (Qiagen) thermal cycler using 1x HOT FIREPol EvaGreen qPCR Mix Plus (no ROX) (Solis BioDyne), 0.2 μM of each primer, and 4 μl of cDNA in a total volume of 10 μl. Each reaction was carried out in 3 biological and 3 technical replicates at the following temperature profile: 95°C– 15 min initial denaturation and polymerase activation (95°C– 25 s, 62°C– 25 s, 72°C– 25 s) x 45 cycles, 72°C– 5 min, with melting curve at 72–99°C 5 s per step. The expression of TaCKX genes was calculated according to the two standard curves method using ADP-ribosylation factor as a normalizer.
Relative expression was related to mean expression of TaCKX3 measured in all organs and set as 1.00. Additionally, all data were counted in relation to the organ correction factor (OCR), which was the quotient of Ct number of the reference gene in the cDNA sample divided by the average Ct number for all samples.
Statistical analysis was performed using Statistica 13 (StatSoft) software. The Kruskal-Wallis test was used to verify the significance of the relative expression differences at the confidence level p<0.05. Correlations coefficients were determined using correlation matrices (Pearson test).

Cells were harvested 48 h after transfection with siRNAs targeting SF3A3 (D‐019808‐03), SNRPD3 (D‐019085‐04), SF3B1 (D‐02061‐07), or SF3B6 (D‐020260‐17) or nontargeting siRNA control NT#1. RNA was isolated using the miRNeasy mini kit (Qiagen, #217004) with an extra on‐column DNase digestion step (Qiagen, #79254) and an initial lysis step using TRIzol reagent (Thermo Fisher Scientific, #15596026). cDNA was prepared with M‐MLV Reverse Transcriptase (Solis BioDyne, Huissen, the Netherlands; #06‐21‐200000), random primers, dNTPs, and RNase out (all from Invitrogen). Real‐time PCR was performed on a Roche LightCycler 480 using the HOT FIREPol^® EvaGreen^® qPCR Mix Plus (no ROX) (Solis BioDyne, #08‐25‐00001). Primers were designed using primer‐blast 3.0 and purchased as custom oligonucleotides from Invitrogen. Primers specific for p53, MDM2, and MDM4 splice variants were designed to cover the exon junctions specific to the variants as shown in Table S2. Each qRT‐PCR experiment was performed in triplicate. Absolute expression levels were determined on the basis of the threshold cycle normalized to β‐actin (2^−ΔCt). Relative expression levels were calculated relative to nontargeting siRNA controls using the ΔΔCt method.

RNA was isolated from treated or untreated cells (RNeasy Mini Kit, Qiagen) and cDNA was synthesised (SensiFast cDNA Synthesis Kit, Bioline). qPCR was performed in a 7500 Real Time PCR System (Applied Biosystems) using SYBR Select Master Mix for CFX (Applied Biosystems) or 5x HOT FIREPol EvaGreen qPCR Mix Plus (no ROX) (Solis BioDyne), as per the manufacturers’ instructions. Primer sequences are as follows: DNMT1 F 5′GAGGAAGCTGCTAAGGACTAGTTC3′, R 5′ACTCCACAATTTGATCACTAAATC3′; GRα F 5′CCATTGTCAAGAGGGAAGGA3′, R 5′CAGCTAACATCTCGGGGAAT3′; GR promoters 1B F 5′GCCGGCACGCGACTCC3′; 1 C F 5′GCTCCTCTGCCAGAGTTGAT3′; 1E F 5′CGTGCAACTTCCTTCGAGT3′; 1F F 5′GTAGCGAGAAAAGAAACTGG3′; 1J F 5′CCGGGGTGGAAGAAGAG3′; Exon 2 R 5′CAGTGGATGCTGAACTCTTGG3′; GAPDH F 5′GAAGGTGAAGGTCGGAGT3′, R 5′GAAGATGGTGATGGGATTTC3′; β-actin F 5′GGCCACGGCTGCTTC3′, R 5′GTTGGCGTACAGGTCTTTGC3′. qPCR data were analysed using the 2^−∆∆CT method^{36 (link)} relative to the geometric mean of the reference genes GAPDH and β-actin^{37 (link)}.

Analyses were performed as described previously. Total RNA was extracted from the 3rd and the 4th leaves using TRI Reagent solutions (Invitrogen, Waltham, MA, USA). Genomic DNA was removed using DNase I, RNase-free (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was synthetized using a Revert Aid cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). Real-Time PCR was carried out using the 5 x HOT FIREPol EvaGreen qPCR Mix Plus (noROX) (Solis BioDyne, Tartu, Estonia) kit and Rotor Gene 6000q Series (Corbett Life Science, Mortlake, Australia) thermalcycler according to the manufacturer’s protocols. The barley ADP-rybosilation factor and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were used as the internal controls. For each gene, three biological replicates were performed in three technical repeats, and the average value of the standard curve and standard error was shown. Gene-specific primers used for real-time PCR were published by Groszyk et al. [11 (link)] and Groszyk and Szechyńska-Hebda [45 (link)].