Log In Sign up
The largest database of trusted experimental protocols

Parkin shrna

Manufactured by Merck Group
Visit Supplier

Parkin shRNA is a laboratory research tool used to study the function of the Parkin gene. It is a short hairpin RNA (shRNA) designed to suppress the expression of the Parkin gene in cells. The core function of Parkin shRNA is to provide a means for researchers to investigate the biological role of the Parkin protein in various cellular processes.

Automatically generated - may contain errors

Lab products found in correlation

Polyjet, by SignaGen (1 mentions) Pspax2, by Addgene (1 mentions) Pmdg 2, by Addgene (1 mentions)

Spelling variants of this product

Parkin (9 citations)

3 protocols using parkin shrna

1

Overexpression and Knockdown of NOD2 and Parkin

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
NOD2-HA in pcDNA3 plasmid was a gift from Dr. Gabriel Nunez lab, Univeristy of Michigan, Ann Arbor, MI. Parkin-Flag construct generated previously (Han et al. 2017 (link)). NOD2 cDNA from the pcDNA3 plasmid was subcloned into a p3×Flag (Sigma) vector using BamHI and KpnI restriction enzymes. Parkin cDNA was subcloned into the pLVX (Clontech) lentivirus expression plasmid. Parkin shRNA (TRCN0000283 and TRCN0000284) and NOD2 shRNA (TRCN0068813, TRCN0068814, and TRCN0362622) lentivirus plasmids were obtained from Sigma. Lentiviruses were amplified by transfecting HEK293T cells with transfer plasmids, pMDG.2 (Addgene #12259) and psPax2 (Addgene #12260). The lentivirus from the cell culture media was filtered using 45 micron filther and concentrated by ultracentrifugation. Lentiviral transduction was performed in the presence of polybrene and the media was changed 24 hr post transduction. Transient transfection was performed on cells at ~80% confluency using PolyJet (Signagen).
Singh K., Han K., Tilve S., Wu K., Geller H.M, & Sack M.N. (2018). Parkin targets NOD2 to regulate astrocyte endoplasmic reticulum stress and inflammation. Glia, 66(11), 2427-2437.
+ Open protocol
+ Expand
2

Knockdown of Parkin and PINK1 Genes in Human Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Parkin and PINK1 shRNAs were obtained from Sigma-Aldrich and Open Biosystems.
Parkin shRNA (Open Bio.)
Company Species Clone Set ID Names Target sequence (5’- −3’)
Open Bio. Human NM_013988 84517 5’-GAGAGAGTTCTCACATTTAAT-3’
Open Bio. Human NM_013988 84518 5’-ACTCACTAGAATATTCCTTAT −3’
Open Bio. Human NM_013988 84520 5’-GAACGTTTAGAAATGATTTCAAA −3’
Parkin shRNA (Sigma)
Company Species Clone Set ID Names Target sequence (5’- −3’)
Sigma (TRC1) Human NM_013988 2399 5’-CGTGAACATAACTGAGGGCAT-3’
Sigma (TRC1) Human NM_013988 341 5’-CGCAACAAATAGTCGGAACAT-3’
Sigma (TRC1) Human NM_013988 425 5’-CGTGATTTGCTTAGACTGTTT-3’
Sigma (TRC1) Human NM_013988 434 5’-CTTAGACTGTTTCCACTTATA-3’
Sigma (TRC1) Human NM_013988 872 5’-CTCCAAAGAAACCATCAAGAA-3’
PINK1 shRNA
Company Species Clone Set ID Names Target sequence (5’- −3’)
Open Bio. Human NM_032409 234804
5’-CGTATGTGCCTTGAACTGAATTAGTGAAGCCACAGATGTAATTCAGTTCAAGG
CACATACGT-3’
Open Bio. Human NM_032409 235108
5’-GGGAGCCATCGCCTATGAAATTAGTGAAGCCACAGATGTAATTTCATAGGCG
ATGGCTCCCA-3’
Open Bio. Human NM_032409 238759
5’-GCCGCAAATGTGCTTCATCTATAGTGAAGCCACAGATGTATAGATGAAGCACA
TTTGCGGCT-3’
Lee S.B., Kim J.J., Han S.A., Fan Y., Guo L.S., Aziz K., Nowsheen S., Kim S.S., Park S.Y., Luo Q., Chung J.O., Choi S.I., Aziz A., Yin P., Tong S.Y., Fiesel F.C., Springer W., Zhang J.S, & Lou Z. (2019). The AMPK-Parkin axis negatively regulates necroptosis and tumorigenesis by inhibiting the necrosome. Nature cell biology, 21(8), 940-951.
+ Open protocol
+ Expand
3

Knockdown of Parkin and PINK1 Genes in Human Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Parkin and PINK1 shRNAs were obtained from Sigma-Aldrich and Open Biosystems.
Parkin shRNA (Open Bio.)
Company Species Clone Set ID Names Target sequence (5’- −3’)
Open Bio. Human NM_013988 84517 5’-GAGAGAGTTCTCACATTTAAT-3’
Open Bio. Human NM_013988 84518 5’-ACTCACTAGAATATTCCTTAT −3’
Open Bio. Human NM_013988 84520 5’-GAACGTTTAGAAATGATTTCAAA −3’
Parkin shRNA (Sigma)
Company Species Clone Set ID Names Target sequence (5’- −3’)
Sigma (TRC1) Human NM_013988 2399 5’-CGTGAACATAACTGAGGGCAT-3’
Sigma (TRC1) Human NM_013988 341 5’-CGCAACAAATAGTCGGAACAT-3’
Sigma (TRC1) Human NM_013988 425 5’-CGTGATTTGCTTAGACTGTTT-3’
Sigma (TRC1) Human NM_013988 434 5’-CTTAGACTGTTTCCACTTATA-3’
Sigma (TRC1) Human NM_013988 872 5’-CTCCAAAGAAACCATCAAGAA-3’
PINK1 shRNA
Company Species Clone Set ID Names Target sequence (5’- −3’)
Open Bio. Human NM_032409 234804
5’-CGTATGTGCCTTGAACTGAATTAGTGAAGCCACAGATGTAATTCAGTTCAAGG
CACATACGT-3’
Open Bio. Human NM_032409 235108
5’-GGGAGCCATCGCCTATGAAATTAGTGAAGCCACAGATGTAATTTCATAGGCG
ATGGCTCCCA-3’
Open Bio. Human NM_032409 238759
5’-GCCGCAAATGTGCTTCATCTATAGTGAAGCCACAGATGTATAGATGAAGCACA
TTTGCGGCT-3’
Lee S.B., Kim J.J., Han S.A., Fan Y., Guo L.S., Aziz K., Nowsheen S., Kim S.S., Park S.Y., Luo Q., Chung J.O., Choi S.I., Aziz A., Yin P., Tong S.Y., Fiesel F.C., Springer W., Zhang J.S, & Lou Z. (2019). The AMPK-Parkin axis negatively regulates necroptosis and tumorigenesis by inhibiting the necrosome. Nature cell biology, 21(8), 940-951.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!