H9 and H1 human embryonic stem cells (hESCs) were obtained from WiCell Research Institute (Madison, WI). GM23338 and ND34391 human iPSCs were purchased from Coriell Institute. PD patient‐derived iPSCs (GBA1‐iPSC‐1 and GBA1‐iPSC‐2; both GBA1 N370S heterozygotes) were obtained as previously described.13 , 14 The use of the commercial cell lines for in vitro research follows our Institutional (Agency for Science, Technology, and Research) guidelines, which do not require specific institutional review board approval. The hESCs and iPSCs were maintained on Matrigel‐coated plates, in mTeSRTM1 (STEMCELL Technologies) media. GBA1−/− isogenic hESC lines were generated using a single guide RNA (5′‐CGCTATGAGAGTACACGCAGTGG‐3′) targeting exon 4 of the human GBA1 gene. For doxycycline‐inducible SNCA overexpression, hemagglutinin (HA)‐tagged SNCA cDNA was cloned into a lentiviral backbone (Addgene, Cambridge, MA; #27150; Fig 1H ) for cell infection. Cells were selected with appropriate antibiotics from day 3 to 7, and 3 clones with overexpression of SNCA were selected.
Lentiviral backbone
Manufactured by Addgene
The Lentiviral Backbone is a plasmid-based vector system used to generate lentiviral particles. It contains the necessary genetic elements for packaging, transducing, and expressing the desired genetic cargo in target cells. The core function of the Lentiviral Backbone is to provide the essential components for the production of recombinant lentivirus.
Automatically generated - may contain errors
2 protocols using lentiviral backbone
1
Generation and Characterization of CRISPR-Engineered PD iPSCs
2
Lentiviral Dual Reporter Construction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
mCherry and P2A-eGFP were PCR amplified with primers containing a BstBI restriction site and adequate overhangs (primer sequences provided in Table S2 ). Both PCR fragments were inserted into XbaI and EcoRI digested lentiviral backbone (Addgene #52962) in a single NEBuilder HiFi DNA Assembly (NEB) reaction. The resulting vector was digested with BstBI. Annealed SARS-CoV-2 or HIV FSE (PRF-1 and PRF0) oligonucleotides were inserted by NEBuilder HiFi DNA Assembly (NEB). The resulting vector (Lenti-mCh-PRF-P2A-eGFP) was then used to generate lentivirus. 1x106 HEK293T cells were seeded per well in a 6-well plate. 24 hours after seeding, cells were transfected with 1 μg Lenti-mCh-PRF-P2A-eGFP, 0.6 μg psPAX2 (Addgene #12260), and 0.4 μg pMD2.G (Addgene #12259) using 5 μl FugeneHD (Promega) transfection reagent. The medium was changed 24 hours post transfection and 48 hours after transfection, viral supernatant was collected and passed through a 0.45 μm filter. HCT116 cells were transduced with viral supernatant in the presence of 5 μg/ml polybrene at a low multiplicity of infection. 48 hours after transduction, single mCherry and eGFP positive cells were sorted into 96-well plates and clonal cell lines were established.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!