The CFX96™ Real-time System PCR instrument is a thermal cycler designed for real-time PCR applications. It provides accurate and reliable temperature control and detection of fluorescent signals during the PCR process.
Total RNA was extracted from cells in each treatment group using an RNA Fastagen Kit and reverse-transcribed into cDNA using a HiScript II 1st Strand cDNA Synthesis Kit (+ gDNAwiper). RT-qPCR was performed using ChamQ Universal SYBR qPCR master mix kit and specific primers for glycerol 3-phosphate dehydrogenase (GAPDH), IL-1β, and IL-8 in a CFX96™ Real-time System PCR instrument (Bio-Rad, CA, USA), with GAPDH as the reference gene. The relative mRNA expression levels of IL-1β and IL-8 were calculated using the 2-△△CT method. The CT value of the PRRSV-JXA1 Nsp9 gene was detected using qRT-PCR with AceQ Universal U+Probe master mix V2 and JXA1 Nsp9 specific primers and probes. All experiments were performed in triplicate. The sequences of the gene-specific primers and probes are listed in Table 1.
RT-qPCR primer and probe sequences.
Table 1
Gene
Primer sequence (5 '−3′)
IL-1β-F
GGAAGACAAATTGCATGG
IL-1β-R
CCCAACTGGTACATCAGCAC
IL-8-F
AGGACAAGAGCCAGGAAG
IL-8-R
CTGCACCTTCACACAGAGC
Nsp9-F
CCTGCAATTGTCCGCTGGTTTG
Nsp9-R
GACGACAGGCCACCTCTCTTAG
JXA1-Nsp9-Probe
ACTGCTGCCACGACTTACTGGTCACGCAGT
GAPDH-F
CCTTCCGTGTCCCTACTGCCAAC
GAPDH-R
GACGCCTGCTTCACCACCTTCT
Yang Y., Luo Y., Yi S., Gao Q., Gong T., Feng Y., Wu D., Zheng X., Wang H., Zhang G, & Sun Y. (2023). Porcine reproductive and respiratory syndrome virus regulates lipid droplet accumulation in lipid metabolic pathways to promote viral replication. Virus Research, 333, 199139.
Gene expression analysis was carried out with the 2X SYBR Green Fast qPCR Mix Kit (RK21204, ABclonal Corporation). qPCR reactions included 1 μL cDNA, 10 μL 2X Supermix, 0.8 μL Primer mix, and 8.2 μL ddH2O. Amplification was performed on a CFX96 Real-Time System PCR instrument (Bio-Rad) and fluorescence values were collected. The relative expression levels of genes were calculated using the 2ˆ(-ΔΔCt) method with TaActin as the internal reference gene. For ChIP-qPCR assay, input DNA and immunoprecipitated DNA were used simultaneously for qPCR detection, with input DNA serving as control. The primers used for qPCR and ChIP-qPCR are listed in Table S6.
Li Y., Jin L., Liu X., He C., Bi S., Saeed S, & Yan W. (2024). Epigenetic control on transcription of vernalization genes and whole-genome gene expression profile induced by vernalization in common wheat. Plant Diversity, 46(3), 386-394.
AP2μ-GFP + cells were first sorted on a BD FACSMelody Cell Sorter. The total RNA was extracted from 1 × 106 Jurkat T cells with the Nucleospin RNA Plus kit (Macherey-Nagel) according to the manufacturer’s instructions. One microgram of the total RNA was reverse transcribed into cDNA with the iScript cDNA synthesis kit (Bio-rad). Quantitative PCR was performed with Luna Universal qPCR MasterMix (New England Biolabs) using the CFX-96™ Real-Time System PCR instrument from Bio-rad. The primers used to detect AP2μ and the housekeeping mRNAs are listed in Supplementary Table 1.
Evnouchidou I., Chappert P., Benadda S., Zucchetti A., Weimershaus M., Bens M., Caillens V., Koumantou D., Lotersztajn S., van Endert P., Davoust J., Guermonprez P., Hivroz C., Gross D.A, & Saveanu L. (2020). IRAP-dependent endosomal T cell receptor signalling is essential for T cell responses. Nature Communications, 11, 2779.
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to
get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required