Plasmid pGEX‐6P‐2‐mhp366 was extracted from recombinant bacteria GST‐Mhp366 (Zhou et al., 2018 (link)) using HiPure Plasmid Micro Kit (Magen). Nucleotide fragment mhp366‐N which contains the corresponding peptide segment recognised by the convalescent serum but not by hyperimmue serum was amplified with two primers 5'‐CGCGGATCC ATGAAAAAAATGGTAAAATATTTTCTAG‐3' (BamH I) and 5'‐CCGCTCGAG CCAAAATGGGCCACCGTT‐3' (XhoI) using PrimeSTAR® Max DNA Polymerase (Takara, China). After that, the PCR product was ligated into vector pET‐28a(+) to construct the recombinant plasmid. Finally, the ligation product was transformed into E. coli DH5α competent cells and was identified by double restriction enzyme digestion and sequencing.
Hipure plasmid micro kit
Manufactured by Magen Biotechnology Co
Sourced in China
The HiPure Plasmid Micro Kit is a laboratory tool used for the purification of plasmid DNA from bacterial cultures. It utilizes a silica-based membrane technology to efficiently capture and purify plasmid DNA from small-scale samples.
Automatically generated - may contain errors
Lab products found in correlation
Primestar max dna polymerase, by Takara Bio (2 mentions)
Pmd19 t vector, by Takara Bio (1 mentions)
Nanodrop nd 2000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Smai restriction enzyme, by New England Biolabs (1 mentions)
Mmessage mmachine t7 transcription kit, by Thermo Fisher Scientific (1 mentions)
Lipofectamine messengermax reagent, by Thermo Fisher Scientific (1 mentions)
4 protocols using hipure plasmid micro kit
1
Cloning and Expression of Mhp366 Peptide
2
Quantifying Heat Shock Protein in MS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The whole genome of MS was downloaded from NCBI, and the sequences were aligned with SnapGene software (California, CA). Conserved heat shock ATP-dependent protease was selected as the detection target. The 784 bp fragment was amplified via PCR by using the primers in Table S1 , cloned into the pMD-19T vector (Takara, Beijing, China) after purification with a gel purification kit (Vazyme, Nanjing, China) and subsequently transformed into E. coli DH 5α competent cells (Genesand, Beijing, China). Tsingke Biotech (Beijing, China) sequenced the recombinant plasmid pMD-19T-ATP for confirmation. Plasmids were extracted with a HiPure Plasmid Micro Kit (Magen), and the concentration was measured by using a NanoDrop ND-2000 spectrophotometer (NanoDrop Technologies, DE). The copy number of pMD-19T-ATP was calculated via the following formula: copies/µL = (6.02 × 1023) × (ng/µL × 10−9)/(length of DNA × 660).
3
Cloning and Expression of Mhp366-N Fragment
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The mhp366-N gene fragment was cloned as previously described [12 (link)]. Briefly, a HiPure Plasmid Micro Kit (Magen, China) was used to extract plasmid pGEX-6P-2-mhp366 from the recombinant bacterium GST-Mhp366 [12 (link)], according to the manufacturer’s instructions. The mhp366-N fragment containing the peptide segment that reacted with M. hyopneumoniae convalescent sera but not hyperimmune sera was amplified using PrimeSTAR® Max DNA Polymerase (Takara, China) and the following primers: 5’-CGCGGATCC ATGAAAAAAATGGTAAAATATTTTCTAG-3’ (BamH I) and 5’-CCGCTCGAG CCAAAATGGGCCACCGTT-3’ (Xho I). A recombinant plasmid was constructed by ligating the PCR product into the vector pET-28a(+). The ligation product was transformed into E. coli DH5α competent cells, and was verified using double restriction enzyme digestion and sequencing.
4
Infectious Clone Plasmid-based Virus Rescue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All infectious clone plasmids were purified using a HiPure Plasmid Micro Kit (Magen, Guangzhou, China). The RNA transcription procedure was performed as previously reported25 (link). Briefly, the plasmid was linearized using SmaI restriction enzyme (NEB, Beijing, China) and was then purified as a template for RNA transcription. An mMESSAGE mMACHINE T7 Transcription kit (Ambion, USA) was used for the transcription of RNA in vitro in a 20 μL reaction with an additional 1.5 μL of GTP solution, which was incubated at 37 °C for 3 h. The DNA template was then removed using DNase I. Afterward, the RNA was purified using the lithium chloride precipitation method, quantitated by spectrophotometry, and stored at –80 °C in aliquots.
For virus rescue, BHK-21 cells were seeded in 12-well plates for 16 h, and the cells (70–90% confluence) were then transfected with 1 μg of RNA per well using Lipofectamine MessengerMAX reagent (Invitrogen, CA, USA). After transfection, the cell plates were incubated at 37 °C with 5% CO2. The harvested supernatants from transfected cells (F0 virus) were used to prepare F1 virus stock, and F1 viruses were confirmed by Sanger sequencing.
For virus rescue, BHK-21 cells were seeded in 12-well plates for 16 h, and the cells (70–90% confluence) were then transfected with 1 μg of RNA per well using Lipofectamine MessengerMAX reagent (Invitrogen, CA, USA). After transfection, the cell plates were incubated at 37 °C with 5% CO2. The harvested supernatants from transfected cells (F0 virus) were used to prepare F1 virus stock, and F1 viruses were confirmed by Sanger sequencing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!