Murine lung epithelial (MLE12) cells (ATCC, Manassas, VA) were cultured with HITES medium containing 10% fetal bovine serum (FBS). RAW264 cells were cultured with DMEM medium containing 10% FBS. The cells were cultured at 37°C in a 5% CO2 incubator. V5 antibody, mammalian expressional plasmid pcDNA3.1 TOPO /His-V5, Escherichia coli Top 10 competent cells, and phospho-serine antibody were from Invitrogen (Carlsbad, CA, USA). FAK, pY576/577-FAK, Flag tag (9A3), GSK3β, and pY216GSK3β antibodies were from Cell Signaling Technology (Danvers, MA, USA). Recombinant mouse IL-33 protein, KC, and mouse IL-6 ELISA kits were from R&D Systems (Minneapolis, MN). ST2L antibody was from Abcam (Cambridge, MA). FITC conjugated ST2L (FITC-ST2L) antibody (DJ8) and a Rat FITC conjugated IgG1 isotope control antibody were from MD Bioproducts (St. Paul, MN). GSK3β shRNA and scrambled shRNA were from Sigma Aldrich (St. Louis, MO, USA). FAK inhibitor and TWS119 were from Cayman Chemical Company (Ann Arbor, MI). Immunobilized protein A/G beads were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). All materials used in these experiments were of the highest grade commercially available.
Scrambled shrna
Manufactured by Merck Group
Sourced in United States
Scrambled shRNA is a laboratory tool used to generate RNA interference (RNAi) constructs. It serves as a negative control in RNAi experiments, as it does not target any known gene. This allows researchers to distinguish the effects of specific gene silencing from non-specific or off-target effects.
Automatically generated - may contain errors
Lab products found in correlation
Escherichia coli top 10 competent cells, by Thermo Fisher Scientific (2 mentions)
V5 antibody, by Thermo Fisher Scientific (2 mentions)
Immunobilized protein a g beads, by Santa Cruz Biotechnology (2 mentions)
Fak inhibitor, by Cayman Chemical (1 mentions)
Phospho serine antibody, by Thermo Fisher Scientific (1 mentions)
Py216gsk3β, by Cell Signaling Technology (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Plko 1 vector, by Addgene (1 mentions)
Rpmi 1640 medium, by Thermo Fisher Scientific (1 mentions)
Penicillin streptomycin, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Dmem medium, by Thermo Fisher Scientific (1 mentions)
Protease inhibitor, by Roche (1 mentions)
Lipofectamin 2000, by Thermo Fisher Scientific (1 mentions)
Recombinant tgf β1, by Thermo Fisher Scientific (1 mentions)
Hek293 cell, by Thermo Fisher Scientific (1 mentions)
Superfect transfection reagent, by Qiagen (1 mentions)
Leupeptin, by Merck Group (1 mentions)
Ammonium chloride nh4cl, by Merck Group (1 mentions)
β actin antibody, by Merck Group (1 mentions)
9 protocols using scrambled shrna
1
Murine Lung Epithelial Cell Culture and Signaling
2
Lentiviral Vector Production Protocol
3
Lentiviral Knockdown of Mouse HKII in Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human cervix carcinoma HeLa cells, human breast cancer MDA‐MB‐231 cells, human malignant peripheral nerve sheath tumor S462 cells, human plexiform neurofibroma PN 04.4 cells, mouse breast cancer 4T1 cells and mouse colorectal carcinoma CT26 cells, mouse macrophage RAW 264.7 cells and, mouse myoblast C2C12 cells were cultured in DMEM medium (Gibco); colorectal carcinoma COLO 741 cells and B‐CLL MEC1 cells were cultured in RPMI 1640 medium (Gibco); both culture media were supplemented with 10% fetal bovine serum (Gibco), glutamine 2 mM (Gibco), and penicillin–streptomycin (100 μg/ml; Invitrogen) and were kept at 37°C in a 5% CO2 humidified atmosphere.
HKII expression was stably interfered by infecting cells with a lentivirus carrying the following shRNAs (Sigma) against mouse HKII mRNA:
HKII expression was stably interfered by infecting cells with a lentivirus carrying the following shRNAs (Sigma) against mouse HKII mRNA:
CCGGCATCACCCTGCTGGTTCTAAACTCGAGTTTAGAACCAGCAGGGTGATGTTTTTG;
CCGGCGGTACAGAGAAAGGAGACTTCTCGAGAAGTCTCCTTTCTCTGTACCGTTTTTG.
4
Silencing PKA Regulatory Subunits in 293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
293T cells were co-transfected with either PRKARIβ or PRKARIIβ rat cDNA (Origene) and with scrambled shRNA (Sigma) or shRNAs targeting PRKARIβ (5’- CGGCAGAAGTCAAACTCACAGTGTGATTC-3’, purchased from Origene) or PRKARIIβ (# 1–5’-CGTCATCGACAGAGGAACATT-3’; # 2–5’-CGATGCAGAGTCCAGGATAAT-3’ and # 3–5’-CCTTCAGGAGAATAATAGTAA-3’). shRNA hairpins were cloned into an NheI site of the p156RRLsin lenti-vector expressing GFP (Dull et al., 1998 (link)). 293T cells growing on 60 mm Petri dishes were transfected with 0.5 µg plasmids encoding either RIβ or RIIβ cDNA, together with 5 µg shRNA against either RIβ or RIIβ, or 5 µg negative control. Transfections were performed using Lipofectamin 2000 (Invitrogen) according to manufactures’ instructions. Protein lysates were prepared 48 hr post-transfection using RIPA buffer supplemented with protease inhibitors (Roche). Western blot analyses carried out using RIβ or RIIβ antibodies as well as actin antibody for loading control were used. Lentiviral particles were then prepared as previously described (Ikawa et al., 2003 (link)).
5
Cell Culture Techniques for Esophageal, Kidney, and Lung Cancer
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Esophageal adenocarcinoma (OE19 and OE33) cancer cells [Sigma-Aldrich (St. Louis, MO, USA)] were cultured with RPMI 1640 medium containing 2 mM glutamine and 10% FBS. HEK293 cells [Invitrogen (Carlsbad, CA, USA)] were cultured with DMEM medium containing 10% FBS. Murine lung epithelia (MLE12) cells [American Type Culture Collection (ATCC), Manassas, VA, USA] were cultured with HITES medium containing 10% FBS. All the cells were cultured at 37°C in 5% CO2. V5 antibody, E-cadherine antibody, mammalian expressional plasmid pcDNA3.1D/His V5 TOPO, Escherichia coli Top 10 competent cells, and recombinant TGFβ1 were from Invitrogen (Carlsbad, CA, USA). HA tag (29 F4), Flag tag (9A3), and ubiquitin (P4D1) antibodies were from Cell Signaling Technology (Danvers, MA, USA). Rac3 antibody was from Proteintech Group (Chicago, IL, USA). FBXL19 antibody was from Abgent (San Diego, CA, USA). Leupeptin, ammonium chloride (NH4Cl), β-actin antibody, individual FBXL19 shRNAs, and scrambled shRNA were from Sigma Aldrich (St. Louis, MO, USA). MG132 and lactacystin from Calbiochem (La Jolla, CA, USA). Immunobilized protein A/G beads were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Superfect transfection reagent was from QIAGEN (Valencia, CA, USA). All materials in highest grades uses in the experiments are commercially available.
6
Lentiviral Knockdown and Overexpression of S1R in Hippocampal Neurons
7
Stable Knockdown of NR4A Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Stable knockdown of human NR4A2, NR4A3, and murine NR4A2 was achieved with the transduction of shRNA using a Mission™ Lentiviral packaging mix as per instructions (Sigma-Aldrich) using THP-1. For controls, cells were transduced with scrambled shRNA (Sigma-Aldrich). Briefly, for THP-1 cells, 150 µl of cells from a stock concentration of 2.5 × 105 cells/ml were pipetted into a 96-well plate; for Raw mac 264.7 cells, 250 µl of cells from a stock concentration of 1.5 × 105 cells/ml were pipetted into a 24-well plate and both were incubated overnight. Hexadimethrine bromide was added to a final concentration of 8 µg/ml followed by the addition of 10 µl of lentiviral particles and subsequent incubation for 48 h in a tissue culture incubator at 37°C. Subsequent to this, puromycin was added to the cells (5 µg/ml), and medium was changed every 3–4 days until resistant colonies were identified and subsequently expanded. Western blotting was used to confirm knockdown levels for human THP-1 cells and qRT-PCR was used for murine Raw mac 264.7.
8
Knockdown of NDC80 in IR-resistant cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The two lentiviral short hairpin RNAs (shRNAs) targeting NDC80 (shNDC80#1, 5′-CAAGGACCCGAGACCACTTAA-3'; shNDC80#2, 5′-GAATTGCAGCAGACTATTAAT-3′) were custom synthesized by Sangon Biotech (Shanghai, China). Each lentiviral NDC80 shRNA was added to cultured IR-resistant cells for 48 h. Stable cells with the NDC80 shRNA were selected using puromycin (10 μg/ml, Sangon Biotech) for a total of 10 days. A scrambled shRNA purchased from Sigma-Aldrich (St. Louis, United States) was used for treating control cells. The protein expression of NDC80 was detected via Western blotting.
9
Lentiviral Transduction of RGCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
IGFBPL1 shRNA and scrambled shRNA (Sigma-Aldrich) were packaged individually into a lentiviral vector (pLKO.1-puro-CMV-TurboGFPTM-igfbpl1 and pLKO.1-puro-CMV-TurboGFPTM-scrambled shRNA) by DOM Vector Core at the University of California at Los Angeles. Transduction was carried out in 96-well culture plates with 0.5 μL of lentivirus stock solution (~1 × 108 TU/ml) in each well that were pre-seeded with 5 × 104 primary RGCs for 6 hours. Cells were allowed to grow for 3 days before analysis.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!