Log In Sign up
The largest database of trusted experimental protocols

Ngfr apc

Manufactured by BD
Visit Supplier

The NGFR-APC product is a laboratory equipment designed for the detection and analysis of nerve growth factor receptor (NGFR) expression. It utilizes fluorescently-labeled antibodies to facilitate the identification and quantification of NGFR-positive cells within a sample.

Automatically generated - may contain errors

Lab products found in correlation

Winlist 3d, by Verity Software House (2 mentions) Cd15 apc, by BD (2 mentions) Cd14 pe, by BD (2 mentions) Facscalibur, by BD (2 mentions) Cd34 pe, by BD (1 mentions) Cd71 apc, by BD (1 mentions) Myocilin, by Santa Cruz Biotechnology (1 mentions) Chi3l1, by R&D Systems (1 mentions) Sybr green, by Thermo Fisher Scientific (1 mentions) High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Confocal laser scanning microscope, by Olympus (1 mentions)

3 protocols using ngfr apc

1

FACS Analysis of Cell Populations

Check if the same lab product or an alternative is used in the 5 most similar protocols
All fluorescence-activated cell sorter (FACS) analyses were performed on a FACScalibur (Becton-Dickinson [BD], Alpen a/d Rijn, the Netherlands) and data were analyzed using WinList 3D (Verity Software House, Topsham, USA). Cells were sorted on a MoFlo sorter. Antibodies: CD34-PE, NGFR-APC, CD14-PE, CD15-APC, CD71-APC and GPA-PE were obtained from BD. Viability was assessed using Annexin V APC (IQ Products, Groningen, The Netherlands) according to the manufacturer's recommendations. Briefly, cells were harvested, resuspended in 100 µL calcium buffer containing 5 µL Annexin V, and incubated for 20 min at 4°C in the dark, washed with 5 mL calcium buffer and binding of APC-conjugated Annexin V was measured by FACS.
Capala M.E., Vellenga E, & Schuringa J.J. (2014). ELMO1 Is Upregulated in AML CD34+ Stem/Progenitor Cells, Mediates Chemotaxis and Predicts Poor Prognosis in Normal Karyotype AML. PLoS ONE, 9(10), e111568.
+ Open protocol
+ Expand
2

Stem Cell Marker Immunofluorescence and qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cells were cultured on coverslips and fixed with 4% paraformaldehyde. Cell permeabilization was achieved using 0.1%Triton X-100 incubation for 20 minutes and blocking with 1% BSA for one hour. Cells were treated overnight at 4°C with primary antibodies for OCT4-FITC (SantaCruz Bioscience), alkaline phosphatase-PE, SSEA4-APC (eBioscience), SSEA1-PerCP (Biolegend), HNK1-PECY7 (Invitrogen), NGFR-APC (BD Pharmingen), CHI3L1 (R&D Systems), and myocilin (SantaCruz). Phalloindin-555 was used to stain F-actin and DAPI was employed as a nuclear stain and samples were acquired using laser scanning confocal microscope (Olympus).
Real-time PCR:
RLT buffer was used for lysis of cultured cells and an RNA purification kit (RNeasy Mini Kit, Qiagen) was used for isolation of total RNAs. RNAs were reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). SYBR green (Applied Biosystems) chemistry was used for qPCR. Primer3 was used to design primers for Housekeeping gene 18S rRNA (Forward: CCCTGTAATTGGAATGAGTCCAC, Reverse: GCTGGAATTACCGCGGCT), myocilin (forward: AAGCCCACCTACCCCTACAC; reverse: TCCAGTGGCCTAGGCAGTAT), CHI3L1 (forward: CCTTGACCGCTTCCTCTGTA; reverse: GTGTTGAGCATGCCGTAGAG), ANGPTL7 (forward: GCACCAAGGACAAGGACAAT; reverse: GATGCCATCCAGGTGCTTAT).
Kumar A., Cheng T., Song W., Cheuk B., Yang E., Yang L., Xie Y, & Du Y. (2020). Two-Step Induction of Trabecular Meshwork Cells from Induced Pluripotent Stem Cells for Glaucoma. Biochemical and biophysical research communications, 529(2), 411-417.
+ Open protocol
+ Expand
3

FACS Analysis and Cell Sorting

Check if the same lab product or an alternative is used in the 5 most similar protocols
All fluorescence-activated cell sorter (FACS) analyses were performed on a FACSCalibur [Becton-Dickinson (BD), Alpen a/d Rijn, The Netherlands] and data were analyzed using WinList 3D (Verity Software House, Topsham, ME). Cells were sorted on a MoFlo sorter. Antibodies NGFR-APC, CD14-PE, and CD15-APC were obtained from BD.
Capala M.E., Pruis M., Vellenga E, & Schuringa J.J. (2016). Depletion of SAM50 Specifically Targets BCR-ABL-Expressing Leukemic Stem and Progenitor Cells by Interfering with Mitochondrial Functions. Stem cells and development, 25(5).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!