S2 cells were grown in Schneider’s Drosophila medium (Sigma-Aldrich) with 10% fetal bovine serum (Gibco BRL), and transfected with Vigofect reagent (Vigorous Biotechnology). dsRNA was synthesized in vitro and transfected as reported (Kulkarni et al., 2006 (link)). Cells were lysed with 10 mM Tris-HCl lysis buffer (pH 7.4, 150 mM NaCl, 0.5 mM EDTA, 0.5% NP-40, 25 mM NaF, and 1 mM Na3VO4 with 1× proteinase inhibitor cocktail [Sigma-Aldrich]). Immunoprecipitations were performed with HA beads (Sigma-Aldrich), Flag beads (Sigma-Aldrich), and GFP beads (Chromotek).
Vigofect reagent
Manufactured by Vigorous Biotechnology
Sourced in China
Vigofect is a transfection reagent developed by Vigorous Biotechnology. It is designed to facilitate the delivery of nucleic acids, such as plasmids, siRNA, or mRNA, into various cell types for research purposes.
Automatically generated - may contain errors
Lab products found in correlation
Fetal bovine serum (fbs), by Thermo Fisher Scientific (4 mentions)
Proteinase inhibitor cocktail, by Merck Group (2 mentions)
Schneider s drosophila medium, by Merck Group (2 mentions)
Gfp beads, by Proteintech (2 mentions)
Flag bead, by Merck Group (1 mentions)
Ha beads, by Merck Group (1 mentions)
Pgl3 basic luciferase reporter plasmid, by Promega (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Prl tk, by Promega (1 mentions)
Peg 8000, by Merck Group (1 mentions)
Goat anti rabbit lgg conjugated to alexa 488, by Thermo Fisher Scientific (1 mentions)
A1r confocal microscope, by Nikon (1 mentions)
Cell culture materials, by Corning (1 mentions)
Acetyl lysine, by Cell Signaling Technology (1 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (1 mentions)
Dual luciferase reporter assay, by Promega (1 mentions)
Hieff trans, by Yeasen (1 mentions)
Dual luciferase reporter assay kit, by Promega (1 mentions)
Polyetherimide pei, by Polysciences (1 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions)
11 protocols using vigofect reagent
1
Drosophila Cell Culture and RNAi
2
Hypoxia-induced RER1 promoter activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Luciferase activity of RER1 promoter was detected in PANC-1 cells in normoxic (21% O2) or hypoxic (1% O2) conditions. Cells were transfected with RER1 luciferase reporter and pSin-HIF-1α or empty vector pSin-vec by Vigofect reagent (Vigorous Biotechnology, Beijing, China). To clone the constructs of RER1 luciferase reporter, primers for RER1 promoter were shown as below: for RER1 forward primer, CTACTCGAGAAAAGAGAGAGAGAGAAGAAAACTAG, reverse primer, CTAAAGCTTTCCAACCATTTCCGCTTCCGGCGCAGACGCG. For RER1 mutant:forward primer, ACAGTGGAGCGCCCTTACGCACCACCAAAG, reverse primer, CTTTGGTGGTGCGTAAGGGCGCTCCACTGT. The promoter fragments were then sub-cloned into pGL3 Basic luciferase reporter plasmid (Promega). For each well, 10 ng pRL-TK (Promega) was transfected together as an internal control. After 24 h of transfection, cells were harvested and luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega, Madison, USA). The results were expressed as the ratio of firefly to Renilla luciferase activity.
3
Lentiviral Labeling of Embryonic Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pSicoR-Ef1a-mCherry-Puro plasmid together with the lentiviral packaging plasmids psPAX2 and pMD2.G were introduced into HEK293T cells using VigoFect reagent (Vigorous Biotechnology), and the transfected cells were cultured for 48 h to allow virus assembly and expansion. The supernatant medium containing viruses was mixed with 10% PEG 8000 (Sigma-Aldrich) and rotated for approximately 12 h at 4 °C. The mixture was then pelleted and resuspended with ESC medium, and the concentrate was subjected to infect ESCs of each line. After the infection, the RFP+ cells were screened and collected using FACS.
To generate chimeric mice, the RFP-labeled ESCs were trypsinized and approximately 10 ESCs were microinjected into each E3.5 blastocyst derived from the ICR mouse strain. These embryos were then implanted into the uteri of female pseudo pregnant ICR mice. 11 days after the implantation, the surrogate mothers were dissected and fetuses were harvested for further investigations. The extent of chimerism in each fetus was determined by the percentage of RFP+ cells using FACS analysis on the skin tissues.
To generate chimeric mice, the RFP-labeled ESCs were trypsinized and approximately 10 ESCs were microinjected into each E3.5 blastocyst derived from the ICR mouse strain. These embryos were then implanted into the uteri of female pseudo pregnant ICR mice. 11 days after the implantation, the surrogate mothers were dissected and fetuses were harvested for further investigations. The extent of chimerism in each fetus was determined by the percentage of RFP+ cells using FACS analysis on the skin tissues.
4
Immunolabeling of Carcinine and Histamine in S2 cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
S2 cells were grown in Schneider’s Drosophila medium with 10% Fetal Bovine Serum (Gibco, Carlsbad,USA), and transfected with vigofect reagent (Vigorous Biotechnology, Beijing, China). Carcinine or histamine was added to the medium to yield final concentrations as indicated in the Figure legends. After incubation for 3h, S2 cells were transferred to poly-L-lysine-coated slices, fixed with 4% paraformaldehyde(for carcinine immunolabeling) or 4% 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDAC)(for histamine immunolabeling) for 30min at 25°C, and incubated with rabbit anti-carcinine/histamine (1:100, ImmunoStar, USA)[9 (link)] or rat anti-carcinine antibodies (1:100, raised by Dr. Gabrielle Boulianne, from the lab of Dr. I. A Meinertzhagen) [18 (link)]. Goat anti-rabbit lgG conjugated to Alexa 488 (1:500, Invitrogen, CA) and goat anti-rat lgG conjugated to Alexa 488 (1:500, Invitrogen, CA) were used as secondary antibodies, and images were recorded with a Nikon A1-R confocal microscope.
5
Lycium barbarum Polysaccharide Regulation of AMPK
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Foetal bovine serum (FBS) was obtained from the PAN (Germany) and HyClone. Cell culture materials were purchased from Corning Incorporated. Dulbecco’s modified Eagle’s medium (DMEM) was supplied by HyClone. Vigofect Reagent was purchased from Vigorous Biotechnology (Beijing, China). Lipofectamine 2000 was obtained from Invitrogen. Antibodies against phospho-AMPKα (#5831)/AMPKα (#2535), phospho-ACC (#3662)/ACC (#3661), LKB1 (#3050) and acetyl-lysine (#9441) were purchased from Cell Signaling Technologies. Antibodies against SIRT1 (13161-AP) and ATGL (55190–1-AP) were obtained from Proteintech. An antibody against FAS (ab22759) was purchased from Abcam. Lycium barbarum polysaccharide (LBP) was supplied by QiYuan Pharmaceutical of Ningxia Hui Autonomous Region (Yinchuan, China).
6
Transfecting 293T cells with reporter plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
M50 Super 8x TOPFlash reporter plasmid[7] (link) (kindly gifted by Dr. Wei Wu) and mutant β-catenin (T41A) plasmids were transfected into 293T cells in 96-well plates using the Vigofect reagent (Vigorous Biotechnology, Beijing, China) according to the supplier's recommendations. The cells were harvested 36–48 h post-transfection. Reporter assays were performed using the Dual-Luciferase Reporter Assay with internal control of Renilla lucicerase plasmid (Promega, Madison, WI, USA, kindly gifted by Dr. Wei Wu) according to the manufacturer's protocol.
7
Transient and Lentiviral Transfection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For transient transfection, cells were plated 12–24 h prior to transfection to achieve 50–70% confluency and then transfected with Hieff Trans (Yeasen, Shanghai, China) or Vigofect reagent (Vigorous Biotechnology, Beijing, China) according to the manufacturer’s protocol. Cells were collected 48 h after transfection.
For generating lentivirus, HEK 293T cells were transfected with pLL-3.7-lnc-RPS6P3 or pSIH-lnc-RPS6P3-shRNA and the packaging plasmids (pLP1, pLP2, and pLP/VSVG) for 48 h. Then the supernatant was collected, followed by filtration with 0.45-μm sterile filters (Merck Millipore, Burlington, MA, USA). For generating stable cell lines, A549 cells were infected with indicated lentiviruses for 12 h. The GFP positive cells were selected by flow cytometry.
For generating lentivirus, HEK 293T cells were transfected with pLL-3.7-lnc-RPS6P3 or pSIH-lnc-RPS6P3-shRNA and the packaging plasmids (pLP1, pLP2, and pLP/VSVG) for 48 h. Then the supernatant was collected, followed by filtration with 0.45-μm sterile filters (Merck Millipore, Burlington, MA, USA). For generating stable cell lines, A549 cells were infected with indicated lentiviruses for 12 h. The GFP positive cells were selected by flow cytometry.
8
Wnt/β-Catenin Signaling Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HCC-Ctrl or HCC-CYP2E1 cells were seeded in 24-well plates and incubated for 24 h at 37 °C. Then the cells were transfected with TOPFlash plasmid (800 ng/well) and pRL-TK plasmid (50 ng/well) using VigoFect reagent (Vigorous Biotechnology). The Dual Luciferase Reporter Assay Kit (Promega, Madison, WI, USA) was employed to to measure Luciferase and Renilla activities 48 h after transfection. The luciferase activity of each sample was normalized with the respective Renilla activity.
9
S2 Cell Transfection and Immunoprecipitation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
S2 cells were grown at 26°C in Schneider’s Drosophila medium (Sigma- Aldrich) with 10% fetal bovine serum (Gibco BRL), dsRNA was synthesized in vitro and transfected as reported [75 (link)]. Plasmids were transfected using Vigofect reagent (Vigorous Biotechnology), and cells were collected and lysed with 10 mM Tris-HCl lysis buffer (pH 7.4, 150 mM NaCl, 0.5 mM EDTA, 0.5% NP-40, 25 mM NaF, and 1 mM Na3VO4 with 1× proteinase inhibitor cocktail [Sigma-Aldrich]). S2 cells were pre-treated with dsRNA against GFP or rack1 for four days, and then transfected with plasmids for two days. To inhibit proteasome activity, cells were treated with 5 μM MG132 for two days. Immunoprecipitations were performed with mCherry beads (Chromotek) and GFP beads (Chromotek). The bound proteins were analyzed by western blotting against Rabbit GFP antibodies (1:1000 dilution, Torrey Pines Biolabs), Mouse FLAG antibodies (1:2000 dilution, Sigma), Rat HA antibodies (1:1000 dilution, Roche), Rabbit Myc antibodies (1:1000 dilution, Sigma), and Rabbit mCherry antibodies (1: 1000 dilution, Biovision).
10
Culturing Diverse Cell Lines for Transfection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Rat intestinal epithelial cells (IEC-6) were cultured in Dulbecco's modified Eagle's medium (DMEM, Invitrogen) supplemented with 5% fetal bovine serum (FBS, GIBCO). Mouse embryonic fibroblasts (MEFs), HaCaT cells, NMuMG, HeLa and HEK293T were cultured in DMEM supplemented with 10% FBS. Caco2 cells were cultured in DMEM supplemented with 20% FBS. MDA-MB-231 and K562 cells were cultured in RPMI 1640 with 10% FBS. HepG2 and Mv1lu cells were cultured in MEM with 10% FBS. All the cell lines were from ATCC except MEFs that were isolated from 14.5 d embryos. IEC-6 cells were transfected with indicated plasmids with Vigofect reagent (Vigorous Biotechnology) according to the manufacturer's instruction. Polyetherimide (PEI, Polysciences) was used for HEK293T transfection.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!