Rad51
RAD51 is a protein involved in the repair of DNA double-strand breaks through homologous recombination. It plays a crucial role in the maintenance of genomic integrity. RAD51 facilitates the search for and invasion of homologous DNA sequences, a key step in the homologous recombination process.
Lab products found in correlation
70 protocols using rad51
Chromatin Immunoprecipitation Assay Protocols
Analyzing DNA Damage Response Proteins
Western Blot Analysis of Cellular Proteins
Immunofluorescence Staining of Fixed Specimens
Proteomic Analysis of DNA Damage Response
Protein Expression Analysis in Cells
Protein Expression in FFPE Tumor Samples
Antibodies and Probes for Cellular Studies
The Telomere probe (CCCTAA)4 and Alu repeat probe (GTGATCCGCCCGCCTCGGCCTCCCAAAGTG) were obtained from Invitrogen and used for dot blots where noted. The C‐rich Cy3‐labeled telomere probe for DNA FISH was obtained from PNA Bio (F1002).
Immunohistochemical Analysis of DNA Repair Proteins
Immunofluorescence Analysis of DNA Damage
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!