Amplitaq dna polymerase

Manufactured by Thermo Fisher Scientific

Sourced in United States, France, Australia

AmpliTaq DNA polymerase is a thermostable enzyme used in polymerase chain reaction (PCR) for the amplification of DNA sequences. It is capable of catalyzing the synthesis of new DNA strands complementary to a template DNA strand.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

AmpliTaq Gold DNA polymerase (404 citations) DNA polymerase (71 citations) AmpliTaq Gold 360 DNA Polymerase (50 citations) AmpliTaq polymerase (17 citations) AmpliTaq 360 DNA Polymerase (11 citations) AmpliTaq Fast DNA polymerase (11 citations) AmpliTaq 360 Gold DNA Polymerases (2 citations) AmpliTaq Gold DNA Polymerase with Buffer II (2 citations) Applied Biosystems AmpliTaq Gold DNA Polymerase (2 citations) AmpliTaq Gold™ DNA Polymerase with Gold Buffer and MgCl2 (2 citations)

99 protocols using amplitaq dna polymerase

PCR Detection of PERV Variants

Check if the same lab product or an alternative is used in the 5 most similar protocols

A conventional PCR was performed to determine the presence of PERV-C. PERV-C was detected using a set of primers with an amplicon length of 288 bp (described as PCR4 in [25 (link)]). It was carried out with AmpliTaq DNA Polymerase (Applied Biosystems, Waltham, MA, USA) and was set up with a Biometra TRIO cycler (Analytik Jena, Jena, Germany). The following temperature-time profile was used: 95 °C for 10 min (activation step), followed by 45 cycles at 95 °C for 15 s (denaturation), 55 °C for 30 s (annealing) and 72 °C for 30 s (extension) and a final extension at 72 °C for 5 min.
A conventional PCR to determine the presence of human-tropic PERV-A/C was set up using specific primer pairs (Table 1) [26 (link)]. The PERV-A/C long primer mix detects an amplicon of 1266 bp length. It was carried out with AmpliTaq DNA Polymerase (Applied Biosystems, Waltham, MA, USA) and was set up with a Biometra TRIO cycler (Analytik Jena, Jena, Germany). The following temperature-time profile was used: 95 °C for 10 min (activation step), followed by 45 cycles at 95 °C for 15 s (denaturation), 55 °C for 30 s (annealing), 72 °C for 90 s (extension) and a final single cycle at 72 °C for 5 min.

Jhelum H., Papatsiros V., Papakonstantinou G., Krabben L., Kaufer B, & Denner J. (2024). Screening for Viruses in Indigenous Greek Black Pigs. Microorganisms, 12(2), 315.

+ Open protocol

+ Expand

Nested PCR Analysis of LCR Methylation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nested PCR was carried out to analyze the overall methylation status of the LCR and methylation variation after demethylation treatment. The primers used for nested PCR are shown in S1 Table, and their products cover 7 methylated/unmethylated (M/U) CpG sites in the 5′-LCR and enhancer region. Bisulfite-modified DNA was first amplified by PCR with the BSP-6 primer set. The BSP was carried out in a 25 μl volume containing 0.2 mM of each of the 4 dNTPs, 2 mM MgCl₂, 10 pmol of each primer, 1.25 units AmpliTaq DNA Polymerase (Applied Biosystems), and 100 ng bisulfite-modified DNA. The BSP conditions were 95°C for 5 min, followed by 25 cycles at 95°C for 60 s, 54°C for 60 s, and 72°C for 2 min, with a final extension at 72°C for 7 min. Then the product from the first round of PCR was subjected to a second round of amplification using methylation-specific PCR primer sets (S1 Table), so methylated and unmethylated sequences could be amplified separately. The PCR was carried out in a 20 μl volume containing 0.2 mM of each of the 4 dNTPs, 2 mM MgCl₂, 10 pmol of each primer, 1.0 unit AmpliTaq DNA Polymerase (Applied Biosystems), and 3 μl product of the first round of BSP. The PCR conditions were 95°C for 5 min, followed by 25 cycles of 95°C for 40 s, 58°C for 40 s, and 72°C for 1 min, with a final extension at 72°C for 7 min.

Zhang C., Deng Z., Pan X., Uehara T., Suzuki M, & Xie M. (2015). Effects of Methylation Status of CpG Sites within the HPV16 Long Control Region on HPV16-Positive Head and Neck Cancer Cells. PLoS ONE, 10(10), e0141245.

+ Open protocol

+ Expand

Microsatellite Genotyping of Leptographium longiclavatum

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted using the methods described in [40] , [41] (link). Microsatellite (simple sequence repeats: SSR) markers developed for G. clavigera[42] were used to genotype a panel of eight L. longiclavatum isolates (data not shown). Ten polymorphic markers were selected for the current investigation (Table 2).
PCR amplification reactions were carried out in either 10 or 14 µL with regard to various markers. Reaction mixture of 10 µL contained 1× PCR buffer, 200 µM each dNTP, 1 pmol of each primer, 0.5 µL labelled M13 (IRDye; LI-COR), 1 µL of AmpliTaq DNA Polymerase (Foster, CA, Invitrogen) and 20 ng of template DNA. Reaction mixture for 14 µl contained 0.71× PCR buffer, 25 mM each dNTP, 0.71 mM MgCL2, 0.71 µM DMSO, 0.71 µM primer, 0.35 µM of each primer (IRDye; LI-COR), 0.35 U of AmpliTaq DNA Polymerase (Foster, CA, Invitrogen), and 5 ng of template DNA. The condition for PCR amplifications was described in [42] .
Genotyping was performed on the LI-COR 4300 DNA analyzer on denaturing polyacrylamide gels with molecular size standards 50–350 bp (IRD-700/800 dye) (LI-COR) and analyzed using the LI-COR SAGA software version 2. The holotype of L. longiclavatum (SL-KW 1436) has been used as the reference isolate to ensure genotyping consistency.

Tsui C.K., Farfan L., Roe A.D., Rice A.V., Cooke J.E., El-Kassaby Y.A, & Hamelin R.C. (2014). Population Structure of Mountain Pine Beetle Symbiont Leptographium longiclavatum and the Implication on the Multipartite Beetle-Fungi Relationships. PLoS ONE, 9(8), e105455.

+ Open protocol

+ Expand

Fungal Gene Replacement Vector Construction

Check if the same lab product or an alternative is used in the 5 most similar protocols

The FGSG_02809, FGSG_02810, and FGSG_02811 genes, including regions upstream and downstream of the open reading frame, were amplified from Fg0407011 by PCR using the HS458/HS459, HS450/HS451, and HS442/HS443 primer pairs, respectively (Table S1). PCR products treated with NotI were inserted into the NotI site in pCB1004 to create the respective transformation vectors pCB02809, pCB02810, and pCB02811 using DNA Ligation Kit Ver. 2 (Takara, Otsu, Japan).
The FGSG_02810 replacement vector pCR402810dis was constructed as follows. The PCR product from FGSG_02810 without NotI treatment was cloned into pCR4TOPO (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions to obtain plasmid pCR402810. The hygromycin-resistance cassette region (TrpC promoter and hygromycin phosphotransferase coding sequence) in pCB1003 (Sweigard et al. 1997 ) was amplified by PCR using primers HS708 and HS709 in which XhoI and SacII recognition sequences were integrated, respectively (Table S1), using pCB1003 as the template DNA.
PCR was performed by using AmpliTaq DNA polymerase (Life Technologies), and the following cycling parameters: 94° for 2 min, 30 cycles of 94° for 1 min, 60° for 1 min, and 72° for 1 min. Amplicons treated with XhoI and SacII were inserted into XhoI and SacII sites in pCR402810 (pCR402810dis) using DNA Ligation Kit Ver. 2.

Suga H., Kageyama K., Shimizu M, & Hyakumachi M. (2016). A Natural Mutation Involving both Pathogenicity and Perithecium Formation in the Fusarium graminearum Species Complex. G3: Genes|Genomes|Genetics, 6(12), 3883-3892.

+ Open protocol

+ Expand

Comprehensive RNA and DNA Extraction and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from cartilage tissues or primary chondrocytes using TRIzol reagent. gDNA was extracted from tissues or cultured cells using PureLink™ Genomic DNA Mini Kit protocol (Thermo Fisher Scientific). RNA was reverse-transcribed using HiScript II Q RT SuperMixfor Q-PCR (+genomic DNA [gDNA] wiper) (Vazyme, Nanjing, China). AmpliTaq DNA Polymerase (Life Technologies) was used for PCR. Then, the complementary DNA (cDNA) and gDNA PCR products were observed using 2% agarose gel electrophoresis. AceQqPCR SYBR Green Master Mix (Vazyme) was used for qPCR. For circRNA and mRNA expressions, GAPDH was used as the internal control. For miRNA expression, U6 was used as the internal control. All primer sequences are listed in Additional file 1: Table 1. The relative expression levels were determined using the 2^−ΔΔCt method.

Liao H.X., Zhang Z.H., Chen H.L., Huang Y.M., Liu Z.L, & Huang J. (2021). CircHYBID regulates hyaluronan metabolism in chondrocytes via hsa-miR-29b-3p/TGF-β1 axis. Molecular Medicine, 27, 56.

+ Open protocol

+ Expand

Generation and Characterization of Stat1 Knockout Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Female FVB/N mice were purchased from the National Cancer Institute and used when 7-9 weeks of age. All mice were group-housed and all experiments were conducted in accordance with NIH and institutional guidelines. Stat1^-/- mice were a generous gift from Dr. David Levy from the Kaplan Cancer Center, New York School of Medicine. Stat1^-/- mice were originally generated on a mixed C57Bl/6 genetic background [35 (link)] and were backcrossed for at least five generations onto the FVB/N background before use. Heterozygous knockout (KO) mice were then mated to generate Stat1^-/- and Stat1^+/+ littermate control mice. Genotypes were determined by PCR analysis of DNA isolated from tail snips using the following primers: (ST11) 5′-GATATAATTCACAAAATCAGAGAG-3′, (ST12) 5′- CTGATCCAGGCAGGCGTTG-3′, (ST13) 5′- TAATGTTTCATAGTTGGATATCAT-3′ in a multiplex reaction utilizing 0.2 mM dNTPs and AmpliTaq DNA polymerase with Buffer I (Life Technologies, Grand Island, NY, USA) with an annealing temperature of 55°C and 33 amplification cycles to detect both wild-type and mutant products (450 and 150 bp, respectively). IFNγR1 KO mice and C57BL/6 wild-type control mice were purchased from The Jackson Laboratory (Bar Harbor, ME, USA).

Bozeman R., Abel E.L., Macias E., Cheng T., Beltran L, & DiGiovanni J. (2014). A Novel Mechanism of Skin Tumor Promotion Involving Interferon-gamma (IFNγ)/Signal Transducer and Activator of Transcription-1 (Stat1) Signaling. Molecular carcinogenesis, 54(8), 642-653.

+ Open protocol

+ Expand

Fungal necC Gene Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

The fungal chromosomal DNA was isolated with DNeasy plant kits (Qiagen, Tokyo, Japan) from grinded frozen mycelium prepared as described above. Forward and reverse degenerate primers, AO1L-f: 5′-aaiisiccigaiggiaaigarwsigtitaygaygc-3′ and AO3L-r: 5′-acitaitaiatrtcrtgrtccatiarncc-3′, were designed from amino acid sequencing data of tryptic peptides to amplify an necC DNA fragment. PCR amplification was conducted using an Expand High Fidelity PCR System (Roche Diagnostics, Tokyo, Japan) and 16 μM of each of the primers with the following program: 94 °C for 2 min; 30 cycles of 94 °C for 15 s, 52 °C for 30 s, 72 °C for 75 s; and 72 °C for 7 min. The PCR product (717 bp) was gel-purified using Qiaquick Gel Extraction Kits (Qiagen) and its inner sequence was then amplified using the primers AO2L-f: 5′-taygtiggiggiccigtitaytgygtiggngg-3′ and AO3L-r with the following program: 94 °C for 2 min; 10 cycles of 94 °C for 15 s, 54 °C for 30 s, and 72 °C for 45 s; and 15 cycles of 94 °C for 15 s, 54 °C for 30 s, 72 °C for 45 s + 5 s per cycle; and 72 °C for 7 min. The gel-purified PCR product was cloned using the pDrive Cloning Vector in a Qiagen PCR Cloning Kit (Qiagen) and sequenced using a Dye Terminator Cycle Sequencing System with AmpliTaq DNA Polymerase (Life Technologies) and a 3730xl DNA Analyzer (Life Technologies).

Miyauchi R., Sakurai H, & Shiba Y. (2016). Characterization of a novel oxidase from Thelonectria discophora SANK 18292 involved in nectrisine biosynthesis. AMB Express, 6, 6.

+ Open protocol

+ Expand

Sanger Sequencing of OBSL1 Variant

Check if the same lab product or an alternative is used in the 5 most similar protocols

The OBSL1 variant was validated using standard Sanger sequencing. A 453 bp region of OBSL1 containing the variant was PCR-amplified using the primers OBSL1-F (5’- GCACAGCATTCTCTCCTTCC -3’) and OBSL1-R (5’- CCAGAGCCCTCTCTTGTCTC - 3’) using 50n g of genomic DNA. The 25 μl reaction consisted of 22 μl PCR master mix (7.8 μl water, 6.3 μl 5M betaine, 3.1 μl 10x PCR buffer (Life Technologies), 1.5 μl 25mM MgCl2, 3.1 μl 2mM dNTP mix, 0.2 μl AmpliTaq DNA polymerase (Life Technologies)), 1μl each primer (50 ng/μl) and 1ul DNA (50 ng/μl). Cycling conditions were 95°C (10 min) followed by 36 cycles of 95°C (15 sec) – 60°C (30 sec) – 72°C (1 min).

Marshall C.R., Farrell S.A., Cushing D., Paton T., Stockley T.L., Stavropoulos D.J., Ray P.N., Szego M., Lau L., Pereira S.L., Cohn R.D., Wintle R.F., Abuzenadah A.M., Abu-Elmagd M, & Scherer S.W. (2015). Whole-exome analysis of foetal autopsy tissue reveals a frameshift mutation in OBSL1, consistent with a diagnosis of 3-M Syndrome. BMC Genomics, 16(Suppl 1), S12.

+ Open protocol

+ Expand

Comprehensive RNA and DNA Isolation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs were isolated by TRIzol reagent (Takara, Dalian, China) according to the manufacturer’s instruction. gDNA was isolated by Genomic DNA Isolation Kit (Sangon Biotech, Shanghai, China). The quality and quantity of RNA and DNA were detected by Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, USA). The nuclear and cytoplasmic fractions were purified by PARIS Kit (Ambion, Life Technologies). RNA was reverse transcribed by HiScript II Q RT SuperMixfor qPCR (+gDNA wiper) (Vazyme, Nanjing, China). The AmpliTaq DNA Polymerase (Life Technologies) was used for PCR. The 2% agarose gel electrophoresis was performed to observe the cDNA and gDNA PCR products. AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China) was used for qRT-PCR, and GAPDH was used to normalize the level of circRNA and mRNA. Hydrolysis probe-based RT-qPCR assay of miRNA was performed according to the manufacturer’s instructions (Applied Biosystems). The miRNA level was normalized by small nuclear U6. Primers are listed in Supplementary Table S3.

Wang Y., Ren F., Sun D., Liu J., Liu B., He Y., Pang S., Shi B., Zhou F., Yao L., Lang Y., Xu S, & Wang J. (2021). CircKEAP1 Suppresses the Progression of Lung Adenocarcinoma via the miR-141-3p/KEAP1/NRF2 Axis. Frontiers in Oncology, 11, 672586.

+ Open protocol

+ Expand

Quantification of circTP63 and miR-873-3p

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was reverse transcribed using HiScript II Q RT SuperMixfor qPCR (+gDNA wiper) (Vazyme, Nanjing, China). The AmpliTaq DNA Polymerase (Life Technologies) was used for PCR. The cDNA and gDNA PCR products were observed using 2% agarose gel electrophoresis. AceQ qPCR SYBR Green Master Mix (Vazyme, Nanjing, China) was used for qRT-PCR. The circRNA and mRNA levels were normalized by β-actin. The miRNA level was normalized by small nuclear U6. The relative expression levels were determined by the 2^−ΔCt or 2^−ΔΔCt method. To determine the absolute quantity of RNA, purified RT-PCR products were used to generate the standard curve. Briefly, circTP63 and miR-873–3p form cDNAs were amplified, purified and measured. Then they were serially diluted to be as templates for qRT-PCR. The standard curves were drawn according to the Ct values at different concentrations. According to the standard curves, copy numbers of circTP63 and miR-873-3p in six LUSC cell lines were calculated. Primers are listed in Supplementary Table 7.

Cheng Z., Yu C., Cui S., Wang H., Jin H., Wang C., Li B., Qin M., Yang C., He J., Zuo Q., Wang S., Liu J., Ye W., Lv Y., Zhao F., Yao M., Jiang L, & Qin W. (2019). circTP63 functions as a ceRNA to promote lung squamous cell carcinoma progression by upregulating FOXM1. Nature Communications, 10, 3200.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!