Primepcr gapdh

Gene expression analysis of cytokines and chemokines involved reverse transcription as described previously (27 (link)) and qPCR assay according to the manufacturer’s instructions (Bio-Rad). RNA was extracted from sorted cells by using Sepasol-RNA I Super G (Nacalai Tesque) and chloroform (Nacalai Tesque), precipitated with 2-propanol (Nacalai Tesque), and washed with 75% (vol/vol) ethanol (Nacalai Tesque). RNA samples were then incubated with DNase I (Invitrogen, Carlsbad, CA, USA) to remove contaminating genomic DNA and reverse-transcribed into cDNA (Superscript III reverse transcriptase, VIRO cDNA Synthesis Kit, Invitrogen). qPCR analysis was performed on a CFX Opus 96 thermocycler (Bio-Rad) by using SsoAdvanced Universal Probes Supermix and PrimePCR Gapdh, Tlr4, Csf2, Ccl2, Ccl3, and Ccl4 primers for mice with FAM probe (Bio-Rad) according to the manufacturer’s protocol.

C57BL6/J mice received 50,000 GFP⁺ BMDCs transduced with TYF-RPE65 or the control TYF-LacZ virus via tail vein injection 7 and 28 days prior to sacrifice and organ harvest. Lung, spleen, and bone marrow were harvested immediately and incubated at 4°C overnight in 5 volumes of RNALater (Life Technologies). Up to 30 mg of tissue was homogenized in RLT Lysis Buffer (Qiagen), and mRNA was isolated as per directions for animal tissue using the Qiagen RNAEasy Mini Kit. Following isolation, mRNA was quantified (ThermoScientific NanoDrop 2000), and cDNA was synthesized from 1 μg RNA per sample as per directions using iScript Reverse-Transcription Supermix (BioRad). To quantify GFP expression in all tissues by qRT-PCR, 1 μL cDNA per sample was combined with 5 μL SsoFast Advanced (BioRad), 3.5 μL dH₂O, and 0.5 μL each of GFP forward (AAGCTGACCCTGAAGTTCATCTGC) and GFP reverse (CTTGTAGTTGCCGTCGTCCTTGAA) primers (10 μM stock; Integrated DNA Technologies), or 0.5 μL GAPDH primer (BioRad PrimePCR GAPDH, Mmu) as an internal control, and run on the BioRad CFX96 qRT-PCR machine as per manufacturer’s directions (SsoFast Advanced, BioRad). GFP expression was calculated as fold of control using the 2^-ΔΔCT method. The sensitivity of this method is sufficient to detect as few as ten cells in a tissue sample.