Pcr purification kit

Rabbit anti-Stat1α (Santa Cruz Biotechnology, TX, USA) was used for the immunoprecipitation and rabbit anti-IgG (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA) was used as a control antibody. Chromatin immunoprecipitation (Ch-IP) was carried out as described [12 (link)], with the exception that the DNA was purified using the PCR Purification Kit (Promega, Fitchburg, WI, USA) and subjected to PCR with the specific primers shown in Supplementary Table 1. A primers set that amplifies the STAT-1 binding sequence on the interferon gamma (IFNG) promoter was used as positive control. A primers set that amplifies a non-specific sequence on the CLU promoter was used as negative control.

PCR reactions were used to amplify 5′-6-[FAM]-labeled DNA fragments containing the iolX promoter region (300 bp) from the DNA of strain 168 using the specific primers [FAM]iolX(−250)-F/iolX (+50)-R and iolX (−250)-F/[FAM]iolX(+50)-R for labeling the sense and antisense strands, respectively (Table 2). Each differentially 5′-6-[FAM]-labeled DNA fragment (0.45 pmol) was incubated in 0.2 ml of binding buffer with varying amounts of IolQ-His₆ at 37 °C for 30 min. 0.75 units of DNase I (Takara Bio) was added to digest the DNA for 5 min, and the reaction was stopped by adding 0.2 ml of 0. 5 M EDTA. DNAs were extracted using a PCR purification kit (Promega). DNA sequencing of the sense and antisense strands employed the primers iolX (−250)-F and iolX (+50)-R, respectively, using the Thermo Sequenase Dye Primer Manual Cycle Sequence Kit (USB). The DNA samples were analyzed by Sigma-Aldrich using an ABI 3130xl Genetic Analyzer and ABI Gene Mapper Software Ver. 4.0 (Thermo Fisher Scientific).

Restriction enzymes, T4 DNA ligase, Taq DNA polymerase, polymerase chain reaction (PCR) reagent, Prime STAR polymerase, and PCR reagent were obtained from Takara Bio Inc. The Endo Hf was purchased from New England Biolabs, Inc. SDS-PAGE Protein Marker was supplied by Thermo Fisher Scientific. Primers were all synthesized at Sangon Biotech (China). PCR Purification Kit was from Promega Corporation. Plasmid Mini Kit and Point mutation kit were from TransGen Biotech (China). All other chemicals used were acquired from Sigma Aldrich Chemicals P Ltd. and Sinopharm Chemical Reagent (China).

The EpiTect Fast Bisulfite Kit (QIAGEN) was used for bisulphite modification of the genomic DNA. The core promoter region of the DHX15 gene, which spans a 260‐nucleotide (nt) fragment with 30 CpG sites from −154 to +96 nt, was amplified through two rounds of PCR using primers (Table S1) designed with the Methyl Primer Express Software v1.0 (Applied Biosystems, Foster City, California). Briefly, the first‐round PCR reaction mixture (12.5 μL) contained 1 μL of modified genomic DNA and 6.25 μL of 2× DreamTaq Green PCR Master Mix (Fermentas, MD, USA). The PCR conditions were as follows: 95°C for 5 minutes, followed by 40 cycles of 95°C for 30 seconds, 50°C for 30 seconds and 72°C for 30 seconds with a final elongation at 72°C for 7 minutes. The second‐round amplification reaction (50 μL) contained 2 μL of the diluted first‐round products (1:100) and was conducted under the same conditions. After purification (TIANGEN PCR Purification Kit, Beijing, China), the purified PCR products were cloned into the pGEM‐T vector (Promega, Madison, WI, USA) according to the manufacturer's instructions. Ten independent clones from each specimen were sequenced (SanGon Biotech Co., Shanghai, China). The methylation level for each CpG site was calculated as the number of methylated CpGs in each site divided by the total number of clones sequenced.

The PCR Purification Kit, Plasmid Mini Kit, and Gel Extraction Kit were from Promega (Madison, WI, USA). HiFiFast DNA polymerase was obtained from BiovisuaLab (Shanghai, China). Lipofectamine 2000 was from Invitrogen (Carlsbad, CA, USA). Survivin expression plasmid was constructed by the Sangon Biotech (Shanghai, China). YM155 was purchased from Selleck chemicals (Houston, TX, USA). Antibodies to IL-24, calreticulin, survivin, phosphorylated JNK and c-Jun, caspase-4, BiP/GRP78, and β-actin were obtained from Abcam (Cambridge, UK). All chemicals and reagents were purchased from Sigma unless noted specifically.

Total RNA was isolated from human healthy liver tissue from our sample collection using Tri Reagent (Molecular Research Centre). cDNA was synthesized using the ProtoScript II reverse transcriptase and oligo (dT). The full-length coding sequence of N-cadherin covering the complete coding region of the Homo sapiens gene was obtained from the NCBI database (accession No. NM_001792.4:425-3145). Primers used for amplification were as follows: F: TAACTCGAGATGTGCCGGATAGC and R: TCATCTAGATCAGTCATCACCTCCA; these include restriction sites for XhoI and XbaI, respectively, for direct cloning into pCI Mammalian expression vector (Promega). The encoding region was amplified using Phusion polymerase (Thermo Fisher Scientific), checked by agarose electrophoresis, purified by Zymo Research PCR purification Kit, digested by XhoI and XbaI and ligated into pCI vector using T4 DNA ligase (Promega) to yield Ncadh-pCI transfection vector. The sequence of the whole insert was verified by Sanger sequencing and primer walking by Eurofins genomics (Germany).