Biomax mr film

ES cells were lysed in lysis buffer (10 mM Tris pH 7.5, 10 mM NaCl, 10 mM EDTA, 0.5% sarkosyl) supplemented with 1 mg/ml proteinase K (Sigma) overnight at 55°C. Genomic DNA was precipitated by adding 2x volume of 66 mM NaCl/ethanol and washed with 70% ethanol. Restriction digestion with NcoI (New England BioLabs) was performed overnight at 37°C. 10 μg of digested DNA was resolved by agarose gel electrophoresis. DNA was de-purinated using 0.2 N HCl for 10 min, washed in deionized water, neutralized with 0.4 N NaOH, and transferred to Hybond-XL membrane (GE Healthcare) by capillary action in 0.4 N NaOH overnight at room temp. Membrane was rinsed briefly with 2x SSC and then pre-hybridized in Church buffer (7% SDS, 158 mM NaH₂PO₄, 342 mM Na₂HPO₄, 1% BSA, 1 mM EDTA) for 2 hours at 65°C. The probe was a ~500-bp PCR fragment (primers: CCTAAATGTCCTATAATCCATTGCTACACA and CGCTTGGTGGATGGAAATATGGTTTTG) labeled using Random Primers DNA Labeling System (Thermo Fisher Scientific) as per manufacturer’s instructions. Labeled probe was denatured at 95°C for 10 min prior to hybridization with membrane at ~1×10⁶ cpm/mL overnight at 65°C. Membrane was rinsed briefly with 2x SSC, then washed twice with 2x SSC/0.1% SDS at 65°C for 20 min each, and again with 0.1x SSC/0.1% SDS at 65°C for 10 min. Membrane was exposed to BioMax MR film (Carestream Health) at −80°C for two days prior to developing.

Adult male Sprague–Dawley rats, weighing 120 g at the start of the experiment, were used. They were housed one per cage with free access to food and water at a constant temperature of 20 °C on a 12:12 reverse light/dark cycle. Lights were off at 8:00 AM.
Each rat received an intraperitoneal injection of 1.5 mg/kg d-amphetamine sulfate (Sigma, St. Louis, MO) or 0.9% saline (1 mL/kg), daily for 10 days, followed by an additional 10 days without any injections.^{47 (link),51 (link)}Rats were briefly anesthetized with 1.5–2% isoflurane, and tails were prewarmed for 5 min with a disposable heating pad to increase vasodilation. A catheter was placed into the lateral caudal tail vein. Subsequently, [³H]MCL-536 (6 μCi/300 g body weight in 200 μL of saline) was injected into the catheter using a 25-gauge needle, followed by 300 μL of saline to ensure that no ligand remained in the catheter. Immediately after injection, the catheter was removed from the tail vein, and the puncture site was sealed with a wound closure strip. At the end of the experiment (60 min), rats were sacrificed, and the brains were removed, cut into transverse sections, and exposed to BioMax MR Film (Carestream) as described above.

After treatment as outlined for individual experiments, lung EC were subsequently washed with cold (4° C) Ca²⁺/ Mg-free PBS and lysed with 0.3% SDS lysis buffer containing protease inhibitors (1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, 1 mM sodium orthovanadate, 1 mM sodium fluoride, 0.2 trypsin inhibitor unit/ml aprotinin, 10 μM leupeptin, and 5 μM pepstatin A). Sample proteins were separated with 4 to 15% SDS-PAGE gels (Bio-Rad, Hercules, CA) and transferred onto Immobilon-P polyvinylidene difluoride membranes (EMD Millipore Corporation). Membranes were then immunoblotted with primary antibodies (1: 1000, 4°C, overnight) followed by secondary antibodies conjugated to horseradish peroxidase (1:5000, room temperature, 30 min) and detected with enhanced chemiluminescence (Pierce ECL or SuperSignal West Dura; Pierce Biotechnology, Rockford, IL) on Biomax MR film (Carestream Health, Rochester, NY).

Western Blots with fluorescent signals were scanned on an Odyssey Imager (LI-COR Biosciences), and when necessary, multiple scans with different detection sensitivity levels were taken to avoid oversaturation. Images were exported as tif files, and protein band intensities were quantified by ImageJ (NIH) or Image Studio Lite (LI-COR Biosciences). Western Blots with chemiluminescence were detected by BioMax MR Film (Carestream) with varied exposure time lengths, and films with appropriate exposure strength were scanned and quantified using ImageJ (NIH). Protein gels stained by Coomassie blue were either imaged by Gel Doc^™ XR+ Gel Documentation System (Bio-Rad) or scanned after drying between cellophane sheets, and the protein band intensities were quantified by ImageJ (NIH). Kinetic analyses were performed by regressions in Prism. Fluorescence signals detected by the Typhoon scanner were quantified by ImageQuant (GE Healthcare). Statistical parameters are reported in the Figures and Figure Legends. Data are judged to be statistically significant when p < 0.05 by two-tailed Student’s t test. Statistical analysis was performed in GraphPad QuickCalcs.