Ta vector

The coding region of the Fra-1 gene was amplified by polymerase chain reaction (PCR). The primer sequences for the Fra-1 gene were 5′-atactcgaatgaacctggccatcagcat-3′ and 5′-gcggaattctcacagggacatgaaatccg-3′. The conditions for PCR amplification were one cycle for 5 min at 94°C; 30 cycles for 45 s at 94°C, 45 s at 55°C, and 90 s at 72°C, and a final cycle for 10 min at 72°C. The coding region fragments of the Fra-1 gene were cloned into the TA vector (Promega, Fitchburg, WI, United States) for transformation in Escherichia coli JM109 (Takara, Dalian, China). In the TA vector, restriction endonuclease xhoi and ecor1 (Promega) were used to cut the required DNA fragments, which were then subcloned into the pEGFP-N1 vector. The accuracy of the cloned sequence was confirmed by DNA sequencing using an ABI 3730 instrument (Applied Biosystems, Foster City, CA, United States).
To construct a stable cervical cancer cell line overexpressing Fra-1, we transfected HeLa cells with the pEGFP-N1/Fra-1 or pEGFP-N1 (blank control vector) using Lipofectin (Invitrogen, Carlsbad, CA, United States) according to the manufacturer’s instructions as described previously (Xiao et al., 2015 (link)). This was followed by G418 selection. Western blotting was performed to detect the expression level of Fra-1 protein to verify successful establishment of the stable cell line.

The ChiP assay was performed as described in Noss et al., 2015 [46 (link)]. PARP-1 antibody was purchased from Genetex (GTX100573). The CCR6DNP fragment was detected by qPCR with 5’ primer: GTGAGAAGTTTGGGAGACATGT and 3’ primer TTGGAAACGCTCTAATAGACCAC. For assessing the frequency of both alleles on the CCR6DNP in wild type HCT116 cells before and after the ChIP assays, CCR6DNP fragments were cloned into TA vectors (Promega) and sequenced by T7 primer.

Two primers, Cssfr6-MF2and Cssfr6-MR1 (Table 1), were designed to amplify a fragment that spanned the region from part of exon 11 to part of exon 14. The amplified PCR products were cloned into TA vectors, and four clones for each of the two alleles were sequenced.
The complete gene was isolated using two pairs of primers, ExpF1 and Cssfr6-MR1 amplifying the gene from the start codon to exon 14, and Cssfr6-MF2 and Lr34-ExpR1 amplifying the gene from exon 11 to the stop codon. The Lr34 PCR products were cloned into TA vectors (Promega), and plasmid DNAs of several individual positive colonies were sequenced. The resistant gene and the susceptibility genes were distinguishable in the overlapped region from exon 11 to exon 14, so the complete gene for each of them was assembled. The entire sequences for each gene were aligned with published Chinese Spring genome sequences of Lr34-A (TraesCS7A01G085800), Lr34-B (pseudogene), and Lr34 (TraesCS7D01G080300) to determine specific sequences for each of the homoeologous genes.