Lightcycler 96 real time pcr detection system

We selected 12 unigenes involved in gentiopicroside production for qRT-PCR experiments. Gene-specific primer pairs were designed by Primer Premier 5.0 software, and SAND1 served as the reference gene [30 (link)]. Total RNA was isolated from the C and M5 samples using TRIzol^® Reagent (Invitrogen) according to the manufacturer’s protocol. After treatment with DNase I (Tiangen, China), 1 μg of RNA was used in reverse-transcription with PrimeScript TM 1st Strand cDNA Synthesis Kits (TaKaRa, Japan). Quantitative reactions were performed on a LightCycler^® 96 real-time PCR detection system (Roche, Switzerland), using SYBR_ Premix Ex Taq^™ (TaKaRa, Japan). Reaction conditions included an initial 95°C for 10 min, then 40 cycles of 95°C for 15 s, followed by 60°C for 25 s. Relative expression levels for each unigene were compared between the two sample types and were calculated by the 2^-ΔΔCt method [31 (link)]. All data were expressed as means ± SD after normalization. Primer sequences used for qRT-PCR are listed in S8 Table.

Total RNA was isolated from tumoral and non-tumoral tissues using RNX-Plus kit (CinnaGen, Iran) and converted into complementary DNA (cDNA) using RevertAid First strand cDNA synthesis kit (Thermo Fisher Scientific, USA). Quantitative reverse transcription PCR (RT-qPCR) was performed in duplicate for each sample based on SYBR Green and a LightCycler 96 Real-Time PCR detection system (Roche, USA) according to the manufacturer’s instructions. For qRT-PCR, LINC00974 primers (Sinaclon, Iran) were: 5′-CCAGTTCATCGCACCTTG-3′ (sense) and 5′-TAGCAATACAGTTCTCGTAGC-3′ (antisense); GAPDH primers (Sinaclon, Iran) were: 5′- AAGGCTGTGGGCAAGGTCATC-3′ (sense) and 5′-GCGTCAAAGGTGGAGGAGTGG-3′ (antisense). The 2^-△△Ct method was used to calculate the relative gene expression levels of LINC00974 and GAPDH, which were normalized to the corresponding GAPDH mRNA levels. Beside RT-qPCR, we also tended to validate our results using a more clinically homogenous dataset with higher number of samples. In this case, we used a GEO dataset, GSE87211 as an external test-set for validation of LINC00974 expression with 202 and 157 CRC and normal cases, respectively.

Total RNA was purified using the miRNeasy mini kit (Qiagen, UK) according to the manufacturer’s instructions and was treated with RNase-free DNase. One (1 (link)) µg RNA was used to synthesize cDNA utilizing Advantage RT-PCR kit (Clontech Laboratories, Mountain View, CA, US). Quantitative RT-PCR was performed in triplicate using 4 µl cDNA mixed with 2x FastStart Essential DNA Green qPCR mastermix (Roche, New York, NY, US) and 0.3 µM forward and reverse primers. Amplifications were performed utilizing the LightCycler 96 Real-time PCR detection system (Roche) using the following cycle conditions: 95°C for 10 min (1 cycle); 95°C for 10 sec, 59°C for 20 sec, 72°C for 30 sec (45 cycles). GAPDH expression levels were used for normalization, and gene expression differences were calculated using the threshold cycle (Ct). Three independent experiments were performed for each reaction, and the obtained values were plotted as mean ± SD. The respective primers are:
GAPDH: 5’-GAGTCCACTGGCGTCTTC-3’ and 5’-GGGGTGCTAAGCAGTTGGT-3’
VEGF-A:5’- CCCACTGAGGAG TCCAACAT -3’ and 5’- TGGATGGTGGTACAGTCAGAG C -3’
IL-8: 5’- GAT CCACAAGTCCTTGTTCCA -3’ and 5’- GCT TCCACATGTCCTCACAA -3’

Total
RNA was isolated using
the Pure-link RNA mini kit (Invitrogen, 12183018A). cDNA was synthesized
using the RevertAid first-strand cDNA synthesis kit (Thermo Scientific,
K1622). PCR amplification and detection were done on Roche LightCycler
96 Real-Time PCR Detection System using FastStart Essential DNA Green
Master (Roche, 06402712001). TATA-box binding protein (TBP) was used
as the internal control for normalization. Relative mRNA levels were
calculated using delta–delta Ct method. Each experiment is
normalized to its own control condition. At least three independent
experiments were done. The primer pairs are listed in Table S1.

The MYOZ1 (accession number XM_005015683) mRNA sequence of ducks in the GenBank was queried, and the fluorescent quantitative primers were designed with the housekeeping gene GAPDH (accession number XM_038180584) as the reference gene (Table 1), synthesized by Nanjing Qingke Biotechnology Co., Ltd. (Nanjing, China). Using the cDNA obtained by reverse transcription as the template, the MYOZ1 and GAPDH genes were amplified with the quantitative primers listed in Table 1, and each sample was set to have three replicates. The equipment used was a Light Cycler 96 Real-Time PCR Detection System (Roche, Basel, Switzerland). A total reaction volume of 20 μL was used, including 10 μL of PowerUp SYBR Green Master Mix (A25742, Thermo Fisher, Beijing, China), 8.2 μL of ddH₂O, 0.4 μL of upstream (10 μM) and 0.4 μL of downstream (10 μM) primers, and 1 μL of cDNA template. Quantitative real-time PCR (qRT-PCR) procedure is as follows: pre-denaturation at 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 10 s and annealing at 60 °C for 30 s; melting curve: 95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 s. The relative mRNA expression in the samples was calculated using the 2^−Δct method.

For RT-qPCR, the total RNA was isolated from CCV-infected cells using RnaExTM (Trizol)^a reagent (GENERAY, China), and reversed transcribed applying a HiScript III RT SuperMix with gDNA wiper (Vazyme, China) following the manufacturer’s instructions. Quantitative PCR was performed with a LightCycler 96 Real-Time PCR Detection System (Roche, USA) using ChamQ Universal SYBR qPCR Master Mix (Vazyme, China) with the following cycle conditions: 95°C for 30 s, followed by 40 cycles of 95°C for 10 s and 60°C for 30 s. To assess the specificity of each amplicon, melt curve analysis was also performed at the end of each thermal profile. The primers used for PCR are listed in Supplementary Table S2. Each individual sample was run in triplicate wells. Fold changes of the selected gene vs 18 s (internal reference) were calculated by the 2^−△△Ct method.

CgFUT1 mRNA expression was analyzed in five tissues of C. gigas via RT-qPCR using two primers (Q-FT1-A and Q-RT1-A; Table 1). SYBR Green RT-qPCR assay was performed using the LightCycler^® 96 Real-time PCR Detection System (Roche, Basel, Switzerland). Β-Tubulin, which is stably expressed in C. gigas [20 (link)], was selected as the internal reference gene (F-TUB and R-TUB; Table 1). The RT-qPCR solution was 20 μL, comprising 10 μL SYBR Green Premix Ex Taq, 0.8 μL forward/reverse primer, 2 μL 10× dilution of cDNA template, and 6.4 μL double distilled H₂O. The cycling conditions were as follows: 95 °C for 3 min, 40 cycles of 95 °C for 5 s, 60 °C for 30 s, and a melting curve analysis from 65 °C to 95 °C. The relative expression of CgFUT1 in five tissues was calculated using the comparative cycle threshold (2^−ΔΔCt) method, and the tissue with the lowest expression was used as the basis of measurement. Three biological replicates were available for each tissue [21 (link)]. SPSS software 19.0 (IBM SPSS Inc., Chicago, IL, USA) was used for data analysis, and data are represented as means ± standard deviation. Duncan’s multiple range test was used for further analysis. Differences were considered significant if the p-value was <0.05.