Mouse neural stem cell nucleofector kit

Manufactured by Lonza

The Mouse Neural Stem Cell Nucleofector Kit is a laboratory equipment designed for the transfection of mouse neural stem cells. It provides a method for the efficient delivery of DNA, RNA, or other molecules into these cells.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Nucleofector kit (131 citations)

8 protocols using mouse neural stem cell nucleofector kit

Gene Knockdown Using siRNA Transfection

Check if the same lab product or an alternative is used in the 5 most similar protocols

For siRNA knockdown, cells were transfected with Silencer Select (Life Technologies) and Stealth RNAi (Invitrogen) targeted to ATXN1L, ATXN1, or TRIM25. Targeted siRNA information can be found in Additional file 15: Table S8B. Each siRNA was tested independently prior to pooled siRNA experiments (data not shown). Control transfections were performed with Stealth RNAi™ siRNA Negative Control, Med GC (12935300, Thermo Fisher Scientific), or BLOCK-iT Fluorescent Oligo (13750062, Invitrogen). FLAG-tagged ATXN1L (#33242) [47 (link)] and FLAG-tagged TRIM25 (#12449) [48 (link)] constructs were purchased from Addgene. Transfections were performed at ~ 70% confluency using TransIT-X2® Dynamic Delivery System (Mirus Bio LLC) or nucleofection (Mouse Neural Stem Cell Nucleofector Kit: VPG-1004, Lonza, Basel, Switzerland) according to the manufacturer’s protocol. Cells were harvested 24–72 h post-transfection for experiments. Stable transfection of FLAG-tagged CIC-S in CIC^KO cells was performed as previously described [30 ].

Wong D., Sogerer L., Lee S.S., Wong V., Lum A., Levine A.B., Marra M.A, & Yip S. (2020). TRIM25 promotes Capicua degradation independently of ERK in the absence of ATXN1L. BMC Biology, 18, 154.

+ Open protocol

+ Expand

Exogenous RBM3 Overexpression in Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

pCEP4 mammalian expression vector was purchased from ThermoFisher Scientific. rbm3 gene was cloned into pCEP4 vector in our previous work for exogenous overexpression (Chip et al., 2011 (link)). The empty vector or RBM3-overexpressing vector was transiently transfected into C17.2 cells by electroporation with Cell Line Nucleofector Kit V (Lonza) using the Nucleofector I device (Lonza). For transfections in primary NSCs, cells were first dissociated from neurospheres to single cells by Trypsin (Sigma) and then transfected with DNA vectors using the Mouse Neural Stem Cell Nucleofector Kit (Lonza) and the Nucleofector I device (Lonza).

Yan J., Goerne T., Zelmer A., Guzman R., Kapfhammer J.P., Wellmann S, & Zhu X. (2019). The RNA-Binding Protein RBM3 Promotes Neural Stem Cell (NSC) Proliferation Under Hypoxia. Frontiers in Cell and Developmental Biology, 7, 288.

+ Open protocol

+ Expand

Zika and Dengue Virus NS2A Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293 cells were cultured in DMEM containing 10% FBS (Hyclone, Logan, UT, USA), 4 mM L-glutamine (Gibco BRL), 100 IU/ml penicillin (Gibco BRL) and 100 μg/ml streptomycin (Gibco BRL). For co-immunoprecipitation experiments, HEK293 cells were transfected with control, ZIKV-NS2A-HA, and DENV-NS2A-HA expressing constructs with Lipofectamine 2000 (Thermo Fisher Scientific) and collected after 48 hr.
Mouse neural progenitors were isolated from E11.5 CD1 mouse embryos and cultured in Neurobasal medium (Gibco BRL) containing 20 ng/ml FGF2, 20 ng/ml EGF, 5 mg/ml heparin, 2% B27 (v/v, Gibco BRL), and 4 mM L- glutamine as previously described (Currle et al., 2007 (link)). High titer lentivirus was produced from HEK293 cells and used to infect mouse neural progenitors in the presence of 4 μg/ml polybrene (Milipore) (Ma et al., 2008 (link)). Mouse neural progenitor lysates were collected 4 days after control, ZIKV-NS2A- or DENV-NS2A-expressing lentivirus for Western blotting analysis. For co-IP analysis, mouse neural progenitors were electroporated with empty lentiviral control vector or pCWX-ZIKV-NS2A-HA by Mouse neural stem cell nucleofector kit (Lonza) and Nucleofector 2b Device (Lonza), and collected 3 days later. Mouse neural progenitors were infected with ZIKV MR766 at MOI 0.08 for 64 hr and collected for Western blotting and quantitative PCR analysis (Tang et al., 2016 (link)).

Yoon K.J., Song G., Qian X., Pan J., Xu D., Rho H.S., Kim N.S., Habela C., Zheng L., Jacob F., Zhang F., Lee E.M., Huang W.K., Ringeling F.R., Vissers C., Li C., Yuan L., Kang K., Kim S., Yeo J., Cheng Y., Liu S., Wen Z., Qin C.F., Wu Q., Christian K.M., Tang H., Jin P., Xu Z., Qian J., Zhu H., Song H, & Ming G.L. (2017). Zika virus-encoded NS2A disrupts mammalian cortical neurogenesis by degrading adherens junction proteins. Cell stem cell, 21(3), 349-358.e6.

+ Open protocol

+ Expand

Co-Immunoprecipitation of RBM3 and IMP2

Check if the same lab product or an alternative is used in the 5 most similar protocols

For co-immunoprecipitation, all pCMV3-based plasmids expressing full-length or truncated RBM3 or IMP2 were transiently transfected into HEK293 cells with FuGENE HD Transfection Reagent (Promega) for 48 h. One to two micrograms of each plasmid was used to transfect 1 × 10⁶ HEK293 cells. For cultured NSPCs, 10 µg pCEP4 empty vector or pCEP4-RBM3 plasmid were transiently transfected into 5 × 10⁶ NSPCs by electroporation, using Mouse Neural Stem Cell Nucleofector Kit (Lonza) and program A-33 of Nucleofector I Device (Lonza). Transfected cells were kept in 12-well plate overnight and then spun down at 100 x g at RT for 5 min to remove dead cells. The remaining viable cells were counted and seeded at the density of 1 × 10⁴ cells/mL into poly-L-lysine coated 16-well chamber slide. Cells were incubated for another 48 h before starting further treatments.

Zhu X., Yan J., Bregere C., Zelmer A., Goerne T., Kapfhammer J.P., Guzman R, & Wellmann S. (2019). RBM3 promotes neurogenesis in a niche-dependent manner via IMP2-IGF2 signaling pathway after hypoxic-ischemic brain injury. Nature Communications, 10, 3983.

+ Open protocol

+ Expand

Targeted Gene Silencing via shRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Targeted gene silencing was performed with shRNA constructs targeting CD276 (Dharmacon) (see Supplemental Methods for construct details). Nucleofection was performed using the Mouse Neural Stem Cell Nucleofector Kit (Lonza, VPG-1004) and Amaxa Biosystems Nucleofector I, program A-33. For each nucleofection, 6 μg of shRNA plasmid was applied to 2 × 10⁶ cells. Following nucleofection, cells were allowed to recover for 24 h in media with 1× antibiotic-antifungal. Expression was then induced with 1 µg/mL doxycycline for 24 h. Selection for transfected cells was performed by adding 1.5 µg/mL of puromycin to media for 48 h, after which cells were harvested for western blot and/or limiting dilution assays.

Johnston M.J., Nikolic A., Ninkovic N., Guilhamon P., Cavalli F.M., Seaman S., Zemp F.J., Lee J., Abdelkareem A., Ellestad K., Murison A., Kushida M.M., Coutinho F.J., Ma Y., Mungall A.J., Moore R., Marra M.A., Taylor M.D., Dirks P.B., Pugh T.J., Morrissy S., St Croix B., Mahoney D.J., Lupien M, & Gallo M. (2019). High-resolution structural genomics reveals new therapeutic vulnerabilities in glioblastoma. Genome Research, 29(8), 1211-1222.

+ Open protocol

+ Expand

Transfection and Lentiviral Silencing Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

DreamFect^TM Gold or DreamFect^TM Transfection Reagents (Oz Biosciences SAS, Marseille, France) were used in accordance with the manufacturer’s protocols. siRNAs transfection in Med1-MB cells was performed by using HiPerFect Transfection Reagent (QIAGEN, Hilden, Germany). siRNAs electroporation in SHH-MB-SLCs was performed by using Mouse Neural Stem Cell Nucleofector® Kit (VPG-1004, Lonza Bioscience, Basel, Switzerland) in accordance with the manufacturer’s protocol. Silencer RNAs (Negative Control, AM4637; siSALL4 #1, MSS246807; siSALL4 #2, MSS246808; siREN/KCTD11, 170461) were purchased by Thermo Fisher Scientific.
Lentiviral particles were generated in HEK293 cells by transiently transfecting the packaging plasmids pCMV-dR8.74 and VSV-G/pMD2 with pLKO.1 plasmids (shCTR SHC002 or shSALL4 #TRCN0000097824 for primary murine SHH-MB cells, and #TRCN0000021878 for SHH-MB PDX cells, Sigma-Aldrich) using calcium phosphate transfection method. Cells were infected with purified lentiviral particles for 72 h.

Lospinoso Severini L., Loricchio E., Navacci S., Basili I., Alfonsi R., Bernardi F., Moretti M., Conenna M., Cucinotta A., Coni S., Petroni M., De Smaele E., Giannini G., Maroder M., Canettieri G., Mastronuzzi A., Guardavaccaro D., Ayrault O., Infante P., Bufalieri F, & Di Marcotullio L. (2023). SALL4 is a CRL3REN/KCTD11 substrate that drives Sonic Hedgehog-dependent medulloblastoma. Cell Death and Differentiation, 31(2), 170-187.

+ Open protocol

+ Expand

CRISPR-Cas9 mCHMP2A Knockout in 4MOSC Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

mCHMP2A-KO was performed on 4MOSC1 and 4MOSC2 cells using the RNP complex protocol provided by Integrated DNA Technologies (IDT; Coralville, Iowa, USA). (Alt-R CRISPR-Cas9 system, IDT). Three CRISPR RNAs (crRNAs) targeting exon 1 of the mCHMP2A gene: crRNA#1, CCAACGACAACCCCTCGGTT; crRNA#2, GTACGCTTGAGTAGTCAAAA; crRNA #3: GTTGTGAGGCCCCTCGACAA were used. RNA oligos are purchased from IDT and resuspended in 1×Tris EDTA (TE), PH 8, solution (IDT, Coralville) to the desired concentration of 200 µM. Designed crRNAs were synthesized with nonspecific Alt-R CRISPR-Cas9 tracrRNA ATTO 550 (IDT #1075927) into gRNAs. 8×10⁵ 4MOSC1 and 4MOSC2 cells were each nucleofected using the Amaxa 2D nucleofector (Lonza) and Mouse Neural Stem Cell Nucleofector Kit (Lonza #VAPG-1004) following the manufacturer’s protocol. After nucleofection, cells were seeded in Matrigel coated plates. 48 hours after nucleofection, cells were plated into Matrigel coated 96 well plates using the limiting dilution method (Corning, Massachusetts, USA). Single clones were collected and deletion of mCHMP2A was assessed by PCR and immunoblotting.

Yun J., Saddawi-Konefka R., Goldenson B., Al-Msari R., Bernareggi D., Thangaraj J.L., Tang S., Patel S.H., Luna S.M., Gutkind J.S, & Kaufman D. (2024). CHMP2A regulates broad immune cell-mediated antitumor activity in an immunocompetent in vivo head and neck squamous cell carcinoma model. Journal for Immunotherapy of Cancer, 12(5), e007187.

+ Open protocol

+ Expand

Enhancer Knockout in Mouse ESCs

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genome engineering was performed as previously described. Briefly, mESCs were nucleofected with Cas9-p2A-mCherry (Jacko et al., 2018 (link)) and plasmids containing appropriate gRNAs (Mali et al., 2013 (link)) using the Mouse Neural Stem Cell Nucleofector Kit (setting A24) in conjunction with the Lonza nucleofector system. To make targeted deletions of enhancers, pairs of gRNAs were designed flanking an enhancer peak spanning approximately 1kb in the genome ensuring deletion of the entirety of highly conserved DNA to ensure complete loss of function. Approximately 36 hours post-electroporation, cells were harvested and FACS-sorted by positive selection to purify cells expressing the mCherry reporter. mCherry-positive cells were plated at low density (~5k cells in 6cm dish) and cultured 6-7 days on mito-C treated mouse embryonic fibroblasts for colony expansion. Individual clones were picked and genotyped by PCR using primers flanking the deletion site by ~200bp on either side in addition to an internal primer to the enhancer. Multiple clones were generated for each enhancer deletion line and characterized to ensure reproducibility.

Closser M., Guo Y., Wang P., Patel T., Jang S., Hammelman J., Nooij J.D., Kopunova R., Mazzoni E.O., Ruan Y., Gifford D.K, & Wichterle H. (2021). An expansion of the non-coding genome and its regulatory potential underlies vertebrate neuronal diversity. Neuron, 110(1), 70-85.e6.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!