The largest database of trusted experimental protocols

Pgfp 5 rs shrna vector

Manufactured by OriGene
Sourced in Japan, United States

The PGFP-V-RS shRNA Vector is a commercially available plasmid designed for the expression of short hairpin RNA (shRNA) in mammalian cell lines. It contains a CMV promoter, an shRNA expression cassette, and a GFP reporter gene.

Automatically generated - may contain errors

4 protocols using pgfp 5 rs shrna vector

1

In Vivo Embryonic Brain Manipulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Pregnant mice were maintained under inhaled isoflurane anaesthesia for the duration of the procedure. The uterine horns were exposed. In some experiments, 1 to 2 μl of Vismodegib (5 mM solution in DMSO; Stratech) or DMSO alone was injected into the lateral ventricle of each embryo’s brain with a glass micropipette. In other experiments, plasmids were injected into the lateral ventricle of each embryo’s brain at 1 to 4 mg mL−1, the embryo in the uterus was placed between tweezer-type electrodes (CUY650; Nepagene), and an electroporator (CUY21E; Nepagene) was used to deliver 6 pulses (30 V, 50 ms each, 950 ms apart). In both cases, the uterine horns were replaced, the abdominal wall was sutured, and animals recovered. Processing was as described above.
Plasmids used in this study were as follows: CAG-FoxG1-IRES-mCherry (kindly provided by Goishi Myioshi, Tokyo Women’s Medical University, Japan); Scrambled shRNA control in pGFP-V-RS shRNA Vector (TR30013, Origene); Smoothened shRNA in pGFP-V-RS shRNA Vector (TG510788, Origene).
+ Open protocol
+ Expand
2

Establishment of LARS1-Overexpressing and Knockdown Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
To establish a stable LARS1-overexpressing SW480 cell line, cells were transfected with 4 μg of empty vector (pCMV6-AC-GFP; PS100010) or LARS1 expression vector (LARS1 human tagged ORF clone; RG221682) from Origene (Rockville, MD, USA) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s recommended procedures. After transfection, stable cell lines (LARS1-2- and -4-SW480 cells) were established after G418 selection (800 μg/mL) for 14 days. To obtain a stable LARS1-knockdown cell line, SW620 cells were transfected with 4 μg of nontargeting control (NC) shRNA (pGFP-V-RS shRNA vector; TR30007) or LARS1 shRNA plasmid (TG303577; Origene, Rockville, MD, USA) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. After transfection, cells were treated with G418 (800 μg/mL) for 14 days and six clones were isolated. Among them, LARS1 shRNA-4- and -5-SW620 cells were efficiently knocked-down and used in this study.
+ Open protocol
+ Expand
3

Transfection and Migration Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols
PGC-1α-HEK293, PGC-1α-1-SW480, PGC-1α shRNA-1-SW620, or NC shRNA-SW620 cells were transfected with NC shRNA (pGFP-V-RS shRNA vector; TR30007) or LARS1 shRNA expression vector (TG303577; Origene, Rockville, MD, USA) using lipofectamine 2000 according to the manufacturer’s instructions. In addition, PGC-1α shRNA-1-SW620 cells were transfected with 4 μg of LARS1 expression vector (LARS1 human tagged ORF clone; RG221682) or empty vector (pCMV6-AC-GFP; PS100010) using lipofectamine 2000 according to the manufacturer’s instructions. After transfection, cells were cultured in 10% FBS-supplemented DMEM for 48 h. These cells, pcDNA-HEK293, pcDNA-SW480, and NC shRNA SW620 cells were then used for cell counting followed by transwell migration and invasion assays.
+ Open protocol
+ Expand
4

Stable TAGLN2 Knockdown in Glioblastoma Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Stable TAGLN2 Knock-down: Short hairpin RNA (shRNA) targeting TAGLN2 were transfected into cells using Lipofectamine 2000 (ThermoFisher Scientific, Waltham, MA) per the manufacturer’s protocol and TAGLN2 knock-down efficiency was measured 48 hours after transfection. For GBM30 cells, shRNA targeting TAGLN2 was purchased from Origene with the following sequences: shRNA#1: CTGTGTGCAGCGGACGCTGATGAATCTGG and shRNA#2: GGCGTCTCAGGCAGGCATGACTGGCT ACG. Control cells were transfected with scrambled shRNA control in the pGFP-V-RS shRNA vector (Origene, Rockville, MD). shRNA #3 targeting human TAGLN2 was purchased from Sigma and transfected into U87 MG cells with the following sequence: CCGGGAACGTGATCGGGTTACAGATCTCGAGATCTGTAACCCGATCACGTTCTTTTTTG (Sigma, St. Louis, MO). Transfection with MISSION pLKO.1-puro Non-Mammalian shRNA Control Plasmid DNA was used for the corresponding scrambled shRNA control (Sigma, St. Louis, MO). Different TAGLN2-targeted shRNAs with greater knock-down efficiency were required for GBM30 cells due to their lower transfection rates. Stable cell lines were maintained in selection media supplemented with puromycin (2 μg/mL) (Sigma, St. Louis, MO).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!