96 well optical pcr plates

Manufactured by Sarstedt

Sourced in Germany

The 96-well optical PCR plates are designed for use in polymerase chain reaction (PCR) applications. These plates provide a standard 96-well format to conduct PCR experiments, allowing multiple samples to be processed simultaneously. The plates are made of an optically transparent material, enabling efficient optical detection during the PCR process.

Automatically generated - may contain errors

Lab products found in correlation

Cfx96 real time system, by Bio-Rad (8 mentions) Rneasy plus mini kit, by Qiagen (6 mentions) Iscript cdna synthesis kit, by Bio-Rad (4 mentions) Ssofast evagreen supermix, by Bio-Rad (4 mentions) Sso fast evagreenr supermix, by Bio-Rad (3 mentions) Cfx manager version 1, by Bio-Rad (3 mentions) Sso fasttm evagreenr supermix, by Bio-Rad (3 mentions) Qiaxpert, by Qiagen (2 mentions) Ssofasttm evagreen supermix kit, by Bio-Rad (2 mentions) Iscripttm cdna synthesis kit, by Bio-Rad (2 mentions) Rneasy micro kit, by Qiagen (1 mentions)

12 protocols using 96 well optical pcr plates

Quantitative Real-Time PCR Analysis of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

For all the experiments RNA was extracted from samples by using the RNeasy Plus Mini Kit (Qiagen) according to the manufacturer’s instructions, and RNA purity and concentration were measured using QIAxpert (Qiagen). Single-strand cDNAs were generated using the iScriptTM cDNA Synthesis Kit (Bio-Rad), and qPCR was performed using the SsoFastTM EvaGreen® supermix kit (Bio-Rad) and specific pairs of primers listed in Table 2. Samples were run in triplicate on 96-well optical PCR plates (Sarstedt AG). Values are expressed as ΔΔCt relative to housekeeping gene HPRT expression. For analysis of Rai transcript in PBLs of CRC and healthy controls the relative gene transcript abundance was determined using ΔCt method and normalized to HPRT.

Table 2

List of the primers used in this study

Gene	Forward 5′-3′	Reverse 5′-3′
RAI	TTACCAGGGAAGCCATCAG	TTGCTCTTTCCCAAGATGCT
HRE1	TGTTAGACACTTTTACAGGCTCAC	TCCTTCAAATCGTCAAATGAACTT
HRE2	CGCTCCATCAGAGGCAACTA	ACCGTTAAAAGCCAGCACAG
CXCR4	TCGTGCCAAAGCTTGTCCCTG	GCGGTAACCAATTCGCGAATAGTGC
TBET	TAATAACCCCTTTGCCAAAGG	TCCCCCAAGGAATTGACAGT
PD-1	GTGTCACACAACTGCCCAAC	CTGCCCTTCTCTCTGTCACC
HPRT	GTAGCCCTCTGTGTGCTCAA	TCACTATTTCTATTCAGTGCTTTGATG

Montecchi T., Nannini G., De Tommaso D., Cassioli C., Coppola F., Ringressi M.N., Carraro F., Naldini A., Taddei A., Marotta G., Amedei A., Baldari C.T, & Ulivieri C. (2024). Human colorectal cancer: upregulation of the adaptor protein Rai in TILs leads to cell dysfunction by sustaining GSK-3 activation and PD-1 expression. Cancer Immunology, Immunotherapy : CII, 73(1), 2.

+ Open protocol

+ Expand

RNA Extraction and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from MEC-Ctr and MEC-p66 cells, generated as previously described [12 (link)], using the RNeasy Micro Kit (Qiagen, Valencia, CA) and subjected to gene array profile analysis using Affymetrix HuGene-2_0-st-v1 arrays (carried out by the Microarray Unit at Cogentech, Milan, Italy).
Total RNA was extracted from B cells from healthy donors, CLL patients, MEC-1 or EBV-B cells using the RNeasy Plus Mini Kit (Qiagen) and retrotranscribed using the iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA). Three independent reverse transcription reactions were performed on each sample. qRT-PCR was performed in triplicate on each cDNA on 96-well optical PCR plates (Sarstedt, Nümbrecht, Germany) using SSo Fast EvaGreenR SuperMix (Bio-Rad) and a CFX96 Real-Time system (Bio-Rad). Results were processed and analyzed using CFX Manager Version 1.5 software (Bio-Rad). Transcript levels were normalized to housekeeping controls. HPRT was used as housekeeping control for all qRT-PCR analyses with the exception of the experiments involving treatment with LSF, for which ACTB (β-actin) was used as this treatment resulted in alternations in HPRT mRNA levels. The primers used to amplify the cDNA fragments are listed in Supplementary Table S2.

Cattaneo F., Patrussi L., Capitani N., Frezzato F., D'Elios M.M., Trentin L., Semenzato G, & Baldari C.T. (2016). Expression of the p66Shc protein adaptor is regulated by the activator of transcription STAT4 in normal and chronic lymphocytic leukemia B cells. Oncotarget, 7(35), 57086-57098.

+ Open protocol

+ Expand

Quantitative Real-Time PCR of RNA Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from MEC transfectants or mouse B lymphocytes and retrotranscribed as previously described.^{37 (link)} Real-time PCR was performed in triplicate on 96-well optical PCR plates (Sarstedt AG, Nümbrecht, Germany) as previously described^{14 (link)} using SSoFast EvaGreen SuperMix (Bio-Rad Laboratories Inc., Hercules, CA, USA) and a CFX96 Real-Time system (Bio-Rad Laboratories, Waltham, MA, USA). Transcript levels were normalized to the housekeeping gene HPRT1.

Patrussi L., Capitani N., Cannizzaro E., Finetti F., Lucherini O.M., Pelicci P.G, & Baldari C.T. (2014). Negative regulation of chemokine receptor signaling and B-cell chemotaxis by p66Shc. Cell Death & Disease, 5(2), e1068-.

+ Open protocol

+ Expand

Quantifying Gene Expression via RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted and retrotranscribed as described (34 (link)). Real-time PCR was performed in triplicate on 96-well optical PCR plates (Sarstedt AG, Nümbrecht, Germany) using SSo FastTM EvaGreenR SuperMix and a CFX96 Real-Time system (Bio-Rad Laboratories, Waltham, MA). Results were processed and analyzed as described (34 (link)). Values are expressed as ΔΔCT relative to the housekeeping gene HPRT1. Primers used for real-time quantitative PCR amplification are listed in Supplementary Table 2.

Boncompagni G., Varone A., Tatangelo V., Capitani N., Frezzato F., Visentin A., Trentin L., Corda D., Baldari C.T, & Patrussi L. (2022). Glycerophosphoinositol Promotes Apoptosis of Chronic Lymphocytic Leukemia Cells by Enhancing Bax Expression and Activation. Frontiers in Oncology, 12, 835290.

+ Open protocol

+ Expand

Quantifying gene expression in Mec-1 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from Mec-1 cells and retrotranscribed as previously described [22 (link)]. Two independent reverse transcription reactions were performed on each RNA sample. Quantitative real-time polymerase chain reaction (qRT-PCR) was performed in triplicate on each cDNA on 96-well optical PCR plates (Sarstedt) using SSo Fast EvaGreenR SuperMix (Bio-Rad) according to the manufacturer’s instructions and a CFX96 Real-Time system (Bio-Rad). After an initial denaturation for 3 min at 95 °C, denaturation in the subsequent 42 cycles was performed for 10 s at 95 °C, followed by 30 s of primer annealing at 60 °C. Results were processed and analyzed using CFX Manager Version 1.5 software (Bio-Rad). Transcript levels were normalized to HPRT1, used as a housekeeping gene. Primers used for amplification are listed in Additional file 1: Table S1.

Capitani N., Lori G., Paoli P., Patrussi L., Troilo A., Baldari C.T., Raugei G, & D’Elios M.M. (2019). LMW-PTP targeting potentiates the effects of drugs used in chronic lymphocytic leukemia therapy. Cancer Cell International, 19, 67.

+ Open protocol

+ Expand

Measuring Gene Expression via qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted and retrotranscribed as described (32 (link)). Real-time PCR was performed in triplicate on 96-well optical PCR plates (Sarstedt) using SSo FastTM EvaGreenR SuperMix and a CFX96 Real-Time system (Bio-Rad Laboratories). Results were processed and analyzed as described (32 (link)). Transcript levels were normalized to HPRT1. Primers used for amplification are listed in Supplementary Table 2.

Tatangelo V., Boncompagni G., Capitani N., Lopresti L., Manganaro N., Frezzato F., Visentin A., Trentin L., Baldari C.T, & Patrussi L. (2022). p66Shc Deficiency in Chronic Lymphocytic Leukemia Promotes Chemokine Receptor Expression Through the ROS-Dependent Inhibition of NF-κB. Frontiers in Oncology, 12, 877495.

+ Open protocol

+ Expand

Astrocyte RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was purified from astrocytes by using the RNeasy Plus Mini Kit (Qiagen, Venlo, The Netherlands) according to the manufacturer’s instructions, and RNA purity and concentration were measured using QIAxpert (Qiagen, Venlo, Netherlands). Single-strand cDNAs were generated using the iScriptTM cDNA Synthesis Kit (Bio- Rad, Hercules, CA, USA), and qRT-PCR was performed using the SsoFastTM EvaGreen^® supermix kit (BIO-RAD, Hercules, CA, USA) and specific pairs of primers for Emp1 (Fwd 5′-3′ GAGACACTGGCCAGAAAAGC; Rev 5′-3′ TAAAAGGCAAGGGAATGCAC), S100a10 (Fwd 5′-3′ CCTCTGGCTGTGGACAAAAT; Rev 5′-3′ CTGCTCACAAGAAGCAGTGG), C3 (Fwd 5′-3′ AGCTTCAGGGTCCCAGCTAC; Rev 5′-3′ GCTGGAATCTTGATGGAGACGC), and Hif-1α (Fwd 5′-3′ TGCTTACACACAGAAATGGCCC; Rev 5′-3′ TATGGCCCGTGCAGTGAAGC). Samples were run in duplicate on 96-well optical PCR plates (Sarstedt AG, Nümbrecht, Germany). Values are expressed as ΔΔCT relative to housekeeping gene GAPDH (Fwd 5′-3′ AACGACCCCTTCATTGAC; Rev 5′-3′ TCCACGACATACTCAGCAC) expression.

Montecchi T., Shaba E., De Tommaso D., Di Giuseppe F., Angelucci S., Bini L., Landi C., Baldari C.T, & Ulivieri C. (2021). Differential Proteomic Analysis of Astrocytes and Astrocytes-Derived Extracellular Vesicles from Control and Rai Knockout Mice: Insights into the Mechanisms of Neuroprotection. International Journal of Molecular Sciences, 22(15), 7933.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted and retrotranscribed as described (Patrussi et al., 2018 (link)). Quantitative real-time PCR (qRT-PCR) was performed on 96-well optical PCR plates (Sarstedt) using SsoFast™ EvaGreen^® Supermix (Bio-Rad, #1725204) using the CFX96 Real-Time system (Bio-Rad Laboratories). Primers used for amplification are listed in Supplementary Table S2. Results were processed and analyzed as described (Patrussi et al., 2018 (link)). The relative gene transcript abundance was determined on triplicate samples using the ddCt method and normalized to either HPRT1 (human-derived samples) or GAPDH (mouse-derived samples).

Lopresti L., Capitani N., Tatangelo V., Tangredi C., Boncompagni G., Frezzato F., Visentin A., Marotta G., Ciofini S., Gozzetti A., Bocchia M., Trentin L., Baldari C.T, & Patrussi L. (2024). p66Shc deficiency in CLL cells enhances PD-L1 expression and suppresses immune synapse formation. Frontiers in Cell and Developmental Biology, 12, 1297116.

+ Open protocol

+ Expand

qRT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from Jurkat, primary T cells and BJ-5at fibroblasts using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-stand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad, #1708891) and analyzed by RT-qPCR on 96well optical PCR plates (Sarstedt) using the SsoFast™ EvaGreen ® Supermix (Bio-Rad, #1725204) and specific primers for human transcripts listed in Table S1. HPRT1 was used as a house-keeping gene to normalize transcript levels.

Cassioli C., Onnis A., Finetti F., Capitani N., Compeer E.B., Dustin M.L., & Baldari C.T. (2020). The Bardet-Biedl Syndrome complex component BBS1 regulates proteasome-dependent F-actin clearance from the centrosome to enable its translocation to the T cell immune synapse.

+ Open protocol

+ Expand

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from THP-1, human B cells and HEK-293 using the RNeasy Plus Mini Kit (Qiagen) and retrotranscribed using the iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). Three independent reverse transcription reactions were performed on each sample. Real-time quantitative PCR (qRT-PCR) was performed in triplicate on each cDNA in 96-well optical PCR plates (Sarstedt, Nümbrecht, Germany) using SSo Fast EvaGreenR SuperMix (Bio-Rad) and a CFX96 Real-Time system (Bio-Rad). Results were processed and analyzed using CFX Manager Version 1.5 software (Bio-Rad). Transcript levels were normalized to HPRT1 used as housekeeping control for all the reactions. The primers sequences are as follow: HPRT1 forward 5’-AGATGGTCAAGGTCGAAG-3’ and reverse 5’-GTATTCATTATAGTCAAGGGCATAT-3’; IRF-1 for-ward 5’-CGTGGGACATCAACAAGGA-3’ and reverse 5’-GTGGAAGCATCCGGTACACT-3’.

Tulli L., Cattaneo F., Vinot J., Baldari C.T, & D’Oro U. (2018). Src Family Kinases Regulate Interferon Regulatory Factor 1 K63 Ubiquitination following Activation by TLR7/8 Vaccine Adjuvant in Human Monocytes and B Cells. Frontiers in Immunology, 9, 330.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!