Total RNA was isolated from all cells using a Total RNA Extraction Kit (Omega BioTek). cDNA was generated from 4 μg of total RNA using the Superscript II cDNA synthesis kit (Invitrogen). Quantitative PCR was performed using GoTaq qPCR reagent (Promega) and transcript levels of MxA, IFN α, IFNβ, p21, p27, Cyclin D1, GAPDH, GADD45, MMP13 were measured on a Bio-Rad System. All qPCR data was normalized to GAPDH expression used as a loading control. Sequences of all primers are shown in Appendix Table 1.
Gotaq qpcr reagent
Manufactured by Promega
Sourced in United States
GoTaq qPCR reagent is a nucleic acid amplification reagent designed for real-time quantitative PCR (qPCR) applications. It contains a DNA polymerase enzyme, necessary cofactors, and a fluorescent dye for detecting and quantifying target DNA sequences.
Automatically generated - may contain errors
2 protocols using gotaq qpcr reagent
1
Quantitative Analysis of Immune and Cell Cycle Genes
2
Quantifying Circular RNA and microRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
According to the kit instructions of GoTaq qPCR Reagent (Promega, Madison, WI, USA, cat. no. A6002), hsa_circ_0006423 and miR-492 were amplified on an Applied Biosystems 7500 Real-time PCR system (ThermoFisher Scientific, Rockford, IL, USA). We designed hsa_circ_0006423 specific divergent primers across the circularization site and miR-492 specific primers. Glyceraldehyde 3-phosphate dehydrogenase was used as the hsa_circ_0006423 external reference, U6 was used as the miR-492 external reference. The primer sequences are shown in Table 1 . The primers were synthesized by Sangon Biotech (Shanghai, China) Co., Ltd. 2−ΔCq and 2−ΔΔCq were used to indicate expression level. 2−ΔCq and 2−ΔΔCq value correlated with expression level.
Primer sequences.
| Primer | Forward primer (5’ to 3’) | Reverse primer (5’ to 3’) |
|---|---|---|
| hsa_circ_0006423(for qPCR) | ACCTTCACCTTCAGAGTTGAGA | CCAGGGGGAACTGGTGATTC |
| GAPDH (for qPCR) | AAGGTGAAGGTCGGAGTCAA | AATGAAGGGGTCATTGATGG |
| miR-492 (for qPCR) | GGCTATGCTTGAGTACG | CTGAGTTAGCGTACGAGT |
| U6 (for qPCR) | GCTTCGGCAGCACATATACTAAAAT | CGCTTCACGAATTTGCGTGTCAT |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!