Genomic DNA was obtained from peripheral blood (EDTA anticoagulation) using a DNeasy Tissue Kit (Tiangen, Biotech, Beijing, China). The entire K8/K18 coding regions (15 exons and their adjacent exon-intron boundaries) of the DNA fragments were analyzed, which had been amplified with a Touchdown polymerase chain reaction protocol using Premix PrimeSTAR HS (TaKaRa, Biotechnology, Dalian, China) and previously described primers[19 (link)] to obtain a high amplification specificity. Messenger RNA sequences of K8 (NM002273) and K18 (NM000224) were used to localize coding variants, while genomic sequences (hKRT8 [M34482] and hKRT18 [AF179904]) were employed for noncoding variants.
Primestar hs premix
Manufactured by Takara Bio
Sourced in China, Japan
PrimeSTAR HS Premix is a high-fidelity PCR premix solution designed for accurate and efficient DNA amplification. It contains a high-performance DNA polymerase, buffer, and dNTPs, optimized for reliable and consistent results.
Automatically generated - may contain errors
Lab products found in correlation
Maxima h minus first strand cdna synthesis kit, by Thermo Fisher Scientific (3 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Dneasy tissue kit, by Tiangen Biotech (1 mentions)
Rnaprep pure kit, by Tiangen Biotech (1 mentions)
Tianamp virus dna kit, by Tiangen Biotech (1 mentions)
Minibest agarose gel dna extraction kit ver 4, by Takara Bio (1 mentions)
Cocl2 6h2o, by Merck Group (1 mentions)
Protein a sepharose beads, by Santa Cruz Biotechnology (1 mentions)
Protein g sepharose beads, by Santa Cruz Biotechnology (1 mentions)
17 aag, by Merck Group (1 mentions)
Dna loading buffer, by Takara Bio (1 mentions)
Quickcut enzyme, by Takara Bio (1 mentions)
Dna marker, by Takara Bio (1 mentions)
Hindiii, by New England Biolabs (1 mentions)
T4 dna ligase, by Takara Bio (1 mentions)
Lipofectamine, by Thermo Fisher Scientific (1 mentions)
Phospho akt, by Cell Signaling Technology (1 mentions)
Bortezomib, by Selleck Chemicals (1 mentions)
Plus reagent, by Thermo Fisher Scientific (1 mentions)
β actin, by Merck Group (1 mentions)
17 protocols using primestar hs premix
1
Targeted Sequencing of K8/K18 Genes
2
RT-PCR Amplification of Human and Hamster Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated from harvested cells using RNAprep Pure kit (Tiangen), and 2 μg total RNA was used in each cDNA synthesis reaction using Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Scientific) with an oligo (dT)18 primer. For GAPDH internal control RT-PCR, primers (GADPH-For, CCATCACCATCTTCCAGGAGCGAGATCC and GAPDH-Rev, GCCTGCTTCACCACCTTCTTGATGTC ) were chosen from fully aligned sequence regions of human and Chinese hamster GAPDH genes so that both upstream and downstream primers have complete matches to both templates. RT-PCR reactions were performed with Premix PrimeSTAR HS (TaKaRa) according to manufacturer’s instructions. For DRD3 RT-PCR, nested PCR was performed. Briefly, two sets of primers, inside and outside primers, were selected from fully aligned human and Chinese hamster DRD3 gene sequences so that all primers (DRD3-out-For, TACCTGGAGGTGACAGGTGGAGTCTGG ; DRD3-in-For, TGCTGTGATGTTTTTGTCACCCTGGATGTC ; DRD3-in-Rev, GAAGGACACCACTGAAGAGTAGATGACAAAATCAGG ; DRD3-out-Rev, GGCAGCCAGCAGACAATGAAGGC ) have perfect matches to both sequences. For the primary PCR, 35 cycles were performed using the outside set of primers with the same PCR enzyme mix as described above. After that, one percent of the primary PCR products were used in the secondary PCR with the inside set of primers and amplified for 25 cycles.
3
HBV Genotyping from Serum Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Virus DNA was extracted from 200 μl of serum using a TIANamp virus DNA kit (Tiangen Biotech Co., Beijing, China) according to the manufacturer's instructions. HBV ISRE region was amplified using primer pairs (forward 5’-GAGTCCCTTTATGCCGCTGT-3’; reverse 5’-GTAAACAAAGGACGTCCCGC-3’), which were synthesized by Beijing Genomics Institute (Beijing, China). PCR was performed using Premix PrimeSTAR HS (Takara, Dalian, China). The amplification reactions consisted of an initial denaturation step of 5 min at 98°C, followed by 35 cycles of 10 s at 98°C, 15 s at 60°C, 40 s at 72°C. The reaction was finalized with a 10 minutes extension at 72°C. The PCR products were sequenced by the Beijing Genomics Institute (Beijing, China). The HBV genotype from each sample was characterized using Genbank HBV genotyping tool (http://www.ncbi.nlm.nih.gov/projects/genotyping/formpage.cgi ).
4
Engineered MARCH7 constructs for cancer cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Wild-type MARCH7 (MARCH7-WT), mutant MARCH7 (MARCH7-Mut), and NOD1 were amplified using Premix-PrimeSTAR-HS (TAKARA, Dalian, China). The DNA fragments were extracted using a MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (TAKARA) and cloned into a pcDNA3.1 (+) empty vector using BamHI and XhoI enzymes (Thermo Fisher Scientific). The MARCH7 (NM_001282805.2) and NOD1 (NM_006092.4) sequences were obtained from the National Center for Biotechnology Information (NCBI). The MARCH7-WT and MARCH7-Mut constructs were tagged with a Flag tag. The plasmids were designed and constructed by Shanghai Yuanmu Biotechnology Co., Ltd. (Shanghai, China). The plasmids were used for stable transfection of cancer cells.
5
Phospho-AKT Signaling Pathway Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Phospho-AKT, polyclonal antibodies against AKT and TNF-α, and the monoclonal antibody against S6 were from Cell Signaling Technology (Beverly, MA). Monoclonal mouse antibodies against cyclin D1, IL6, and HSP90 (Santa Cruz Biotechnology, CA), GAPDH (Abcam Biotechnology, Cambridge, MA), β-actin (Sigma-Aldrich, St. Louis, MO), and His (Quanshijin Biotechnology, Beijing, China) were also used.
Protein A-sepharose beads and protein G-sepharose beads were purchased from Santa Cruz Biotechnology. Bortezomib was obtained from Selleck (Shanghai, China), and 17-AAG and CoCl2·6H2O were obtained from Sigma-Aldrich. Lipofectamine and PLUS reagent were purchased from Invitrogen Life Technologies. The wild-type prokaryotic IDH2 expression vector (EX-C0462-B01) was from FulenGen Co., Ltd. (Guangzhou, China). The empty eukaryotic vector pCMV6-AC-Myc-His was purchased from Origene Technologies (Rockville, MD). The restriction endonucleases HindIII and MluI were obtained from New England Biolabs (MA). Premix PrimeSTAR HS, QuickCut enzyme, T4 DNA ligase, DNA Marker, and DNA Loading Buffer were purchased from Takara (Kusatsu, Japan). Primer synthesis (TableS1 ) and sequencing were completed by Sangon Biotech (Shanghai, China).
Protein A-sepharose beads and protein G-sepharose beads were purchased from Santa Cruz Biotechnology. Bortezomib was obtained from Selleck (Shanghai, China), and 17-AAG and CoCl2·6H2O were obtained from Sigma-Aldrich. Lipofectamine and PLUS reagent were purchased from Invitrogen Life Technologies. The wild-type prokaryotic IDH2 expression vector (EX-C0462-B01) was from FulenGen Co., Ltd. (Guangzhou, China). The empty eukaryotic vector pCMV6-AC-Myc-His was purchased from Origene Technologies (Rockville, MD). The restriction endonucleases HindIII and MluI were obtained from New England Biolabs (MA). Premix PrimeSTAR HS, QuickCut enzyme, T4 DNA ligase, DNA Marker, and DNA Loading Buffer were purchased from Takara (Kusatsu, Japan). Primer synthesis (Table
6
Genomic DNA Extraction and BAP1 Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from manually-collected samples of the cancer tissue portion in the FFPE tissue specimens using the QIamp DNA mini kit (QIAGEN) according to the FFPE protocols. DNA yield and quality were determined using Nanodrop (Thermo Scientific). For sequencing the 17 coding exons of BAP1, the primers listed in S4 Table were designed using Primer-BLAST (National Center for Biotechnology Information, Bethesda, MD, USA). PCR amplification was performed in a total volume of 25μl containing 100ng DNA, 10pmol of each primer and 0.625 units of PrimeSTAR HS Premix (Takara Bio). DNA amplification was performed in a PCR Thermal cycler Dice (Takara Bio). The PCR was started with 10 seconds at 98°C followed by 40 cycles of denaturation for 10 seconds at 98°C, annealing at 60°C for 15 seconds and extension at 72°C for 90 seconds followed by a final extension at 72°C for 90 seconds and cooling down for 10 minutes at 4°C. All PCR products were purified with QIAquick PCR Purification Kit (QIAGEN).
Capillary Sanger sequencing was conducted using an Applied Biosystems 3730xl DNA analyzer (Applied Biosystems) in Macrogen Japan Corp. (Kyoto, Japan)
Capillary Sanger sequencing was conducted using an Applied Biosystems 3730xl DNA analyzer (Applied Biosystems) in Macrogen Japan Corp. (Kyoto, Japan)
7
Site-Directed Mutagenesis by PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Appropriate pairs of mutagenic primers (Supplementary Table S1 ) were synthesized and used to generate the mutated construct by PCR. HA-DHCR7 was used as the template for PrimeSTAR® HS Premix (Takara). After PCR, wild-type plasmid remaining in the PCR product was selectively digested by DpnI (New England Biolabs). The digested PCR product was transfected into E. coli strain DH5α. Desired mutant was confirmed by Sanger sequence analysis.
8
Measuring USP35 Promoter Activity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To measure the USP35 promoter activity, we amplified the −1260/+269 regions (containing FBS and CHR) of the human USP35 promoter from BAC clone (#RPCI-11; 480O10, Empire Genomics) by PCR using the primers containing Xho1 and HindIII restriction sites, respectively. This fragment was cloned into a pGL3-basic firefly luciferase reporter vector after digestion with Xho1 and HindIII enzymes (NEB). PCR-based site-directed mutagenesis was performed to generate a single point mutation in a FoxM1 binding site (5'-TAAACA-3' → 5'-TAACCA-3') of USP35 promoter region using PrimeSTAR® HS Premix (Takara). The sequences of these vectors were verified by DNA sequencing. HEK293T cells were transfected with pRL-renilla luciferase reporter vector and WT USP35 promoter vector or its mutant vector or in combination with Myc-FoxM1. The luciferase assays were performed using Dual-Glo® Luciferase Reagent (Promega) on a SpectraMax® M3 (Molecular Devices). All data were normalized to renilla luciferase activity.
9
Quantitative Analysis of Hepatitis B Virus
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNase-treated RNA was reverse transcribed using PrimeScript reverse transcription (RT) master mix (TaKaRa Bio, Inc.). The target region of HBV RNA and HBV DNA was amplified using the following barcoded pair of primers (Fig. S2): HBV QS-FW, 5′-AGACGAAGGTCTCAATCGCC-3′ (nucleotides [nt] 2393 to 2412), and HBV QS-RV, 5′-GTTCCCAAGAATATGGTGACCC-3′ (nt 2814 to 2835). The PCR mixture (50 μl) contained 25 μl of PrimeStar HS premix (TaKaRa Bio, Inc.), 1 μl of forward primer (10 μM), 1 μl of reverse primer (10 μM), 5 μl of DNA or cDNA template, and 18 μl of double-distilled water. The PCR cycling conditions were as follows: 95°C for 5 min, 35 cycles at 95°C for 15 s, 56°C for 30 s, and 72°C for 30 s, with a final extension of 72°C for 6 min. Deep sequencing of the PCR products was performed using an Illumina MiSeq platform according to the manufacturer’s 2 × 300-bp paired-end-sequencing protocol.
10
Multiplex Genotyping of Fungal Resistance
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tub2F/Tub2R were used to amplify a part of the Tub2 gene containing the SNPs associated with MBC resistance (Table 2 ). In order to detect species, chemotypes and MBC resistant genotypes simultaneously, we combined Tub2F/Tub2R and six previously developed primer pairs (Ward et al., 2008 (link)) for a multiplex amplification. Amplifications were performed in 20 µl volumes with PrimeSTAR HS Premix (Takara), and approximately 100 ng of genomic DNA. PCR conditions consisted of an initial denaturation of 90 s at 94 °C, followed by 40 cycles of 30 s at 94 °C, 30 s at 50 °C, and 1 min at 68 °C. PCR products were treated with ExoSAP-IT (USB) to remove primers and unincorporated dNTPs and served as template for allele-specific primer extension reactions.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!