Anti p21 waf1 cip1 12d1 antibodies

ChIP assays were performed with MDMs using a ChIP assay kit (Millipore, #17–295) according to the manufacturer’s instructions. Briefly, cross-linked cell chromatin was sheared by sonication for 10 min at 40 W (duty factor: 20%, peak incident power: 200, cycles per burst: 200) with a Covaris S220 (Woodingdean, UK). The chromatin fragments were then immunoprecipitated with 20 μg anti-p21 Waf1/Cip1 (12D1) antibodies (Cell Signaling Technology, #2947) or with equal amounts of a rabbit IgG isotype control. The DNA bound to the chromatin immunoprecipitates was eluted and analyzed by qPCR using Power SYBR Green PCR Master Mix (Applied Biosystems #4367659) for the detection of the SIRPα promoter sequence (SIRPA 2) with specific primers (SIRPA 2 forward (5’CCACCGAGACACCTGGCCAG3’ and SIRPA 2 reverse (5’AAGTGAACGCAGGGGGAAGG3’). The specificity of promoter sequence detection was confirmed with negative qPCR primer controls that targeted an unrelated promoter sequence at −2000 bp upstream of the 5’ end of the SIRPA 2 promoter (Untarget-SIRPA 2 forward (5’CCGTGGGTCTCAATGGCTTC3’ and Untarget-SIRPA 2 reverse (5’GGGGGATTAGGAAACTGGAG3’). The DNA amount was normalized by quantifying albumin gene copies with qPCR using a human genomic DNA (20 ng/µl) standard (Roche, #11691112001) as we previously described^{17 (link)}.