Veriquest fast sybr green qpcr reagent

The levels of mRNA in cultured cells were analyzed by reverse-transcription PCR and quantified by quantitative real-time PCR (qPCR). The forward and reverse primers to analyze SDC1 or SDC2 expression used in PCR were listed as referred [24 (link)]. The cDNAs were synthesized by MMLV HP reverse transcriptase (Epicentre, Madison, WI, USA) using freshly prepared RNA as PCR template. Quantitative real-time PCR were performed using VeriQuest Fast SYBR green qPCR reagent (Affymetrix Inc., Santa Clara, CA, USA) in a StepOne Plus real-time PCR system (Thermo Fisher Scientific Inc., Pittsburgh, PA, USA). The 2^-ΔΔCT method was used to determine the relative gene expression using GAPDH as control. The p-value of < 0.05 or < 0.01 was statistically significant and was indicated in each figures.

The levels of mRNA in cultured cells were analyzed by qPCR. The cDNAs were synthesized by MMLV HP reverse transcriptase (Epicentre Inc., Madison, Wisconsin, USA) using freshly prepared RNA as PCR template. Quantitative real-time PCR was performed using VeriQuest Fast SYBR green qPCR reagent (Affymetrix Inc., Santa Clara, California, USA) in a StepOne Plus real-time PCR system (Thermo Fisher Scientific Inc., Pittsburgh, Pennsylvania, USA). The 2^-ΔΔCT method was used to determine the relative gene expression using GAPDH as control. The p-value of < 0.05 or < 0.01 was statistically significant and was indicated in each figure. The forward and reverse primers used were: ANPEP, gccgtgtgca caatcatcgcact and caccagggagcccttgaggtg; SDC1, gctctggggatgactctgac and gtattctcccccgaggtttc; SDC2, ccagccgaagaggatacaaa and gcgttctccaaggtcatagc; Integrin αV, agatctggaccaggatggtt and atctgtggctcctttcattg; Integrin α6, caagatggctacccagatat and ctgaatctgagagggaacca; Integrin β1, gttacacggctgctggtgtt and ctactgctgacttagggatc; Integrin β2, tgcgtcctctctcaggagtg and ggtccatgatgtcgtcagcc; Integrin β3, accactgatgccaagactca and gcatcaacaatgagctggag; Integrin β4, aacgatgaacggtgccacct and ctccacgatgttggacgagt; GAPDH, gagtcaacggatttggtcgt and gatctcgctcctggaagatg.