Usp24

Tumor tissues obtained from GC patients and mice were fixed with 4% paraformaldehyde for 24 h, then embedded with paraffin, and then cut into sections of 4‐μm thickness. After dewaxing, dehydration, and thermal repair of antigen, the slices were incubated with 3% hydrogen peroxide for 20 min and 5% BSA for 40 min, respectively, and then incubated with specific antibodies.²⁴ The antibodies of primary antibody are as follows: USP24 (1:100; Abcam), PLK1 (1:100; Abcam), Ki67 (1:200; Cell signaling Technology), and Notch 1 (1:100; Abcam).

An appropriate amount of tissues or cells were taken from each experimental group, and 1 mL TRIzol was added, and total RNA was extracted according to the instructions.²⁵ All samples were tested three times. The specific primers are USP24 5′‐ TGGACGCGGAGAAGAATGATG‐3′ and 5′‐ CTCGCTTGTAAGGGATGGACC‐3′, PLK1 5′‐ AAAGAGATCCCGGAGGTCCTA‐3′ and 5′‐ GGCTGCGGTGAATGGATATTTC‐3′, glucose transporter 1 (GLUT1) 5′‐ GGCCAAGAGTGTGCTAAAGAA‐3′ and 5′‐ ACAGCGTTGATGCCAGACAG‐3′, hexokinase (HK2) 5′‐ GAGCCACCACTCACCCTACT‐3′ and 5′‐ CCAGGCATTCGGCAATGTG‐3′, lactic dehydrogenase A (LDHA) 5′‐ ATGGCAACTCTAAAGGATCAGC‐3′ and 5′‐ CCAACCCCAACAACTGTAATCT‐3′, and PDK1 5′‐ CTGTGATACGGATCAGAAACCG‐3′ and 5′‐TCCACCAAACAATAAAGAGTGCT‐3′.
Then SDS‐PAGE electrophoresis was performed to separate the SDS denaturing glue containing the target band and transfer it to nitrocellulose membrane for membrane transfer. Subsequently, they were enclosed with 5% skim milk for 90 min and incubated with specific antibodies. The antibodies were USP24 (1:1000; Abcam), P16 (1:1000; Abcam), CDK4 (1:1000; Abcam), Cyclin E (1:1000; Cell signaling Technology), PLK1 (1:2000; Abcam), Notch 1 (1:1000; Abcam), Hes 1 (Cell signaling Technology), and HEY1 (Cell signaling Technology).