To assess the soil microbial diversity, DNA was extracted from 250 mg of each soil sample (stored at -19 °C) using the DNeasy PowerSoil-htp 96 well DNA isolation kit (Qiagen, France). Microbial diversity was further analyzed as described in Garland et al. (2021)80 (also shown in the Supplementary Methods ). Briefly, amplicons of bacterial and archaeal 16S rRNA genes were generated in two steps following Berry et al. (2011)82 (link) in two separate sequence data sets, one for each domain. The fungal ITS2 region was amplified using the PacBio SMRT Sequencing platform (Pacific Biosciences, CA) with the primers ITS1f (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) targeting the entire ITS region (~630 bp) 83 ,84 (link). Cercozoa diversity was estimated with a two-step PCR to amplify a fragment (c. 350 bp) of the V4 region of the 18S rRNA gene using the primers sets designed by Fiore-Donne et al. (2018)85 (link) for the specific amplification of cercozoa. Finally, the diversity of soil bacterial, fungal, archaeal, and cercozoan communities was assessed using the Shannon-Weaver index of diversity, and richness was calculated as the number of observed operational taxonomic units (OTU).
Dneasy powersoil htp 96 well dna isolation kit
Manufactured by Qiagen
Sourced in France
The DNeasy PowerSoil-htp 96 well DNA isolation kit is designed for the rapid and efficient extraction of microbial DNA from a variety of soil and environmental samples. The kit utilizes a 96-well plate format, allowing for the simultaneous processing of multiple samples.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using dneasy powersoil htp 96 well dna isolation kit
1
Comprehensive Soil Microbial Diversity Analysis
2
Comprehensive Soil Microbial Diversity Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assess the soil microbial diversity, DNA was extracted from 250 mg of each soil sample (stored at -19 °C) using the DNeasy PowerSoil-htp 96 well DNA isolation kit (Qiagen, France). Microbial diversity was further analyzed as described in Garland et al. (2021)80 (also shown in the Supplementary Methods ). Briefly, amplicons of bacterial and archaeal 16S rRNA genes were generated in two steps following Berry et al. (2011)82 (link) in two separate sequence data sets, one for each domain. The fungal ITS2 region was amplified using the PacBio SMRT Sequencing platform (Pacific Biosciences, CA) with the primers ITS1f (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) targeting the entire ITS region (~630 bp) 83 ,84 (link). Cercozoa diversity was estimated with a two-step PCR to amplify a fragment (c. 350 bp) of the V4 region of the 18S rRNA gene using the primers sets designed by Fiore-Donne et al. (2018)85 (link) for the specific amplification of cercozoa. Finally, the diversity of soil bacterial, fungal, archaeal, and cercozoan communities was assessed using the Shannon-Weaver index of diversity, and richness was calculated as the number of observed operational taxonomic units (OTU).
3
Comprehensive Soil Microbiome Characterization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To assess the microbial diversity, DNA was extracted from 250 mg of each soil sample (stored at -19°C) using the DNeasy PowerSoil-htp 96 well DNA isolation kit (Qiagen, France). Microbial diversity was further analyzed as described in Garland et al. (2021) 32 . Brie y, amplicons of bacterial and archaeal 16S rRNA genes were generated in two steps following Berry et al. (2011) 33 in two separate sequence data sets, one for each domain.. The fungal ITS2 region was ampli ed using the PacBio SMRT Sequencing platform (Paci c Biosciences, CA) with the primers ITS1f (CTTGGTCATTTAGAGGAAGTAA) and ITS4
(TCCTCCGCTTATTGATATGC) targeting the entire ITS region (~ 630 bp) 34, 35 . Cercozoa diversity was estimated with a two-step PCR to amplify a fragment (c. 350 bp) of the V4 region of the 18S rRNA gene using the primers sets designed by Fiore-Donne et al. ( 2018) 36 for the speci c ampli cation of cercozoa. Finally, alpha diversity of soil bacterial, fungal, archaeal, and cercozoan communities was assessed using the Shannon-Weaver index of diversity.
(TCCTCCGCTTATTGATATGC) targeting the entire ITS region (~ 630 bp) 34, 35 . Cercozoa diversity was estimated with a two-step PCR to amplify a fragment (c. 350 bp) of the V4 region of the 18S rRNA gene using the primers sets designed by Fiore-Donne et al. ( 2018) 36 for the speci c ampli cation of cercozoa. Finally, alpha diversity of soil bacterial, fungal, archaeal, and cercozoan communities was assessed using the Shannon-Weaver index of diversity.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!