Q5 polymerase

Diversity was introduced into the Fc at 10 positions as indicated in Table 1 using degenerate overlapping 40-mer DNA oligomers (Sigma-Aldrich; primers in Table S1) spanning from the KpnI restriction site before the signal sequence to an XhoI restriction site within the Fc gene. The XhoI restriction site (CTCGAG) which was introduced into the genes coding for Fc residues P343/R345/E346 (CCTCGAGAA). Assembly PCR with 4 μM of each 40-mer and Q5 Polymerase (New England Biolabs) was used to create the mutated Fc fragments, and the assembled DNA was amplified with primers FCLibF01 and FCLibR12 by Q5 Polymerase, gel purified and digested, then ligated into pPy-FcDisp using the KpnI and XhoI restriction sites.

Human RGS7 cDNA (NM_001282778) was cloned from HEK293T cDNA using PfuUltra II Hotstart PCR Master Mix (Agilent Technologies, Santa Clara, CA) according to manufacturers’ instructions, using the following forward and reverse primers: tgaccaggatccgccaccatggcccaggggaataattatgggcagaccagc, ggtcagcggccgctcacttatcgtcgtcatccttgtaatctaacaggttagtgctggccc. A FLAG tag was introduced onto the C-terminus of RGS7 during the cloning procedure. PCR products were cloned into the pCDF1-MCS2-EF1-Puro vector via the BamHI and NotI restriction sites. The p.R44C mutation was introduced using fusion PCR site-directed mutagenesis, using the following forward and reverse primers: ggaattcctatttgtacggtcaaaagc, gcttttgaccgtacaaataggaattcc. The p.E383K was introduced into the wild-type using Q5 polymerase (NEB), phosphorylating the PCR product using PNK (NEB) and self ligating it using Quick Ligase (NEB). Primer pairs were: gaaaatatggcaagagtttctgg, ctgaactcttgagggtacttctttaata. The p.V56C, point mutation was introduced into the p.R44C by synthesizing the full vector using Q5 polymerase (NEB), phosphorylating the PCR product using PNK (NEB) and self ligating it using Quick Ligase (NEB). Primer pairs were: GCTTCTCTGGTTCAGACATTGTT, AGCTAGGTATCTTGGAAAGAAAGC.

Ten hatchling larvae (10 dpf) per experimental group, expressing EGFP in the heart, were transferred to a 1.5 ml tube and total RNA was isolated using Trizol reagent (Thermo Fisher Scientific, 15596026), according to the manufacturer's instructions. DNase-treated total RNA (1 µg) was used to synthesize cDNA. PCR was carried out with Q5 polymerase (NEB, M0491) using 1× Q5 buffer, 200 µM dNTPs, 0.5 µM RT_Ubi fwd primer, 0.5 µM RT_mmGFP rev primer (Table S1), 2 µl of cDNA and 0.02 units/µl Q5 polymerase. Cycling parameters were: 94°C for 2 min; 35 cycles of 94°C for 15 s, 60°C for 30 s and 72°C for 1 min; 72°C for 5 min. PCR products were analyzed in an agarose gel and sequenced.

The de novo-synthesised chloramphenicol acetyltransferase (cat) gene from pBRT1Nc was amplified by polymerase chain reaction (PCR) using Q5 polymerase at 1 unit/µL (NEB, Hitchin, UK) and 5NotIdifcat and 3NotIdifcat primers (diluted 1:10 in sterile water from a stock solution of 100 pmol/µL). The DifCAT cassette that was generated was cut with a NotI restriction enzyme (NEB, Hitchin, UK) and ligated to generate Xer-cise plasmids pUCpW_difCAT and pUCpF_difCAT using Quick-Stick Ligase (Bioline Reagents Limited, London, UK) and Top10 E. coli competent cells (see Results) [41 (link)]. These were also amplified with primers rfbEdelF and rfbEdelR (designed with homologous 5′ sequences to rfbS and rfbX genes, respectively) and Q5 polymerase (NEB, Hitchin, UK) to create a rfbE chromosomal deletion cassette.

Individual samples were amplified before pooling using Q5 polymerase (from 2 × master mix purchased from NEB) and previously validated Illumina qPCR primers at a final concentration of 300 nM. Between 2 and 10 μl of template was used in a 50 μl PCR reaction. Sequencing libraries were quantified using quantitative PCR. Q5 polymerase (NEB) was used according to the manufacturer's instructions. Previously validated Illumina qPCR primers43 (link) were synthesized by IDT and used at a final concentration of 300 nM. Syto13 (Molecular Probes/Life Technologies) was used as a fluorescent indicator dye according to the manufacturer's instructions. DNA standards 1–6 from the Kapa NGS library quantification kit were used to make a standard curve for absolute concentration determination (sample qPCR data are shown in Supplementary Fig. 2b).