Abi stepone

The total RNAs were extracted from the cells and cortical tissues and subjected to the cDNA synthesis and real-time PCR (ABI StepOne^TM, Applied Biosystems, Foster City, CA, USA) according to our previously reported methods [42 (link)]. The levels of mRNA expression were calculated using the ΔΔC_t method and normalized with β-actin. Oligonucleotide sequences used in PCR were 5’-CCAGTCCCAAACACTGTCCT and 5’-ATGCCAGTGAGCTTCCCGTTCAGC for CD163; 5’-GGAATCTGCATGGGCAACCTGTGT and 5’AGGGTCTACGTCTCGCAAGCCA for arginase 1; and 5′-AAGTCCCTCACCCTCCCAAAAG and 5′-AAGCAATGCTGTCACCTTCCC for β-actin.

Rats (n = 8 per group) were euthanized and decapitated. Total RNAs were extracted from the ipsilateral cortical tissues and corresponding gastrocnemius tissues using a TriZol RNA isolation reagent (Invitrogen, Carlsbad, CA, USA) and subjected to conventional cDNA synthesis and SYBR-based quantitative real-time PCR [31 (link)]. PCR was performed with the ABI StepOne^TM (Applied Biosystems, Foster City, CA, USA) and levels of mRNA contents were calculated using the ΔΔCT method. Oligonucleotides used for the PCR were as follows: rat IL-6, 5′-ATGAAGTTTCTCTCCGCAAGA and 5′-CTAGGTTTGCCGAGTAGACCT, and rat β-actin, 5′-AGAGGGAAATCGTGCGTGAC and 5′-CAATAGTGATGACCTGGCCGT.

Whole lungs were perfused free of blood via right ventricular perfusion with 10 mL of pre-warmed saline, rapidly excised en-bloc, blotted and snap frozen in liquid nitrogen. Total RNA was extracted using RNeasy kits (Qiagen), reverse transcribed with SuperScript III (Invitrogen), and triplicate real time PCR reactions were performed with Applied Biosystems pre-developed assay reagents, as previously described^{18 (link)}. Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA) or SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and analyzed on ABI StepOneTM and StepOnePlusTM Real-time PCR Systems (Perkin-Elmer Applied Biosystems, Foster City, CA, USA). The PCR primers for TNF-α, IL-1β, IFN-β, IL-6, CCL3, CSF3, CXCL2 and IL-17A were included in the Assayon-Demand Gene Expression Assay Mix (Applied Biosystems, Foster City, CA, USA). Additionally, a custom designed forward and reverse primer of the segment 3 polymerase (PA) of influenza virus was used to measure viral titres. Data are presented relative to the GAPDH mRNA and normalised to the naive control.

Quantitative PCR (qPCR) was performed on M. domestica and D. radicum cDNA using an ABI StepOne instrument (Thermo Fisher Scientific) with ΔΔCT methodology. In all cases 3 biological replicates containing 5 pooled insects for each target gene and time point were analysed, except for endogenous gene expression experiments. Primers were designed using Primer express software for real-time PCR v 2 (Applied Biosystems) (Supplementary Table S1). Reaction mixtures (20 μl) contained 1x SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma Aldrich), ROX as a reference dye, 20 μM PCR primers and 200 ng of cDNA or water as a negative control. Reactions were run in triplicate and analysis of amplification profiles was carried out using StepOne software (Thermo Fisher Scientific). The qPCR assays were conducted according to MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments) guidelines. GAPDH was used as the reference gene for normalisation of Diap1 gene expression. Following qPCR the obtained RQ data was plotted using GraphPad Prism 6 software.

Total RNA was extracted from lung cancer tissues using Trizol (Invitrogen, Inc). The amount and purity of RNA were measured spectrophotometrically on Ultrospec 5300 pro (Amersham Biosciences). Genomic DNA was removed from RNA samples by digestion with DNaseI, according to the manufacturer’s instructions. First strand cDNA was synthesized from 5 μg of total RNA using the oligo (dT) primers and Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (Invitrogen, Inc) according to the manufacturer’s instructions. Real-Time PCR was used to quantify transcript levels and performed on the ABI StepOne real-time PCR using Absolute Blue SYBR green PCR mix (Thermo Fisher Scientific). The following primers were used: USP33 (5′-TGTGATGCTTAGGCAAGGAG-3′ and 5′-GGCCCTCCACCATAAATAGA-3′); Robo1 (5′-GCATCGCTGGAAGTAGCCATACT-3′ and 5′-CTAGAAATGGTGGGCTCAGGAT-3′); GAPDH (5′-GGAGCGAGATCCCTCCAAAAT-3′ and 5′-GGCTGTTGTCATACTTCTCATGG-3′). We used a 2-step amplification (40 cycles of 95°C, 15 s; 60°C, 30 s; 72°C, 30 s; followed by melting temperature determination stage) and fold enrichment was calculated by the 2^−ΔΔCT method.

The mutation identification of later probands in Families 9–12 was performed through targeted next-generation sequencing. A NimbleGen capture panel (Roche, Basel, Switzerland) was designed and assessed to detect potential variants in the probands. The capture panel comprised 10,308 bp that covered all exons together with flanking intronic regions (± 15 bp) of the NF1 and NF2 genes.
Genomic DNA was extracted using a QIAamp DNA Blood Midi Kit (QIAGEN, Hilden, Germany) in accordance with the manufacturer’s instructions. Genomic DNA was then fragmented for the paired-end library (200–250 bp) using an ultrasonicator LE220 (Covaris, Woburn, MA, USA). The library was enriched through array hybridization at 47 °C for 64–72 h, with elution and post-capture amplification afterwards. The library was then inspected using a 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA) and ABI StepOne (Thermo Fisher Scientific, Waltham, MA, USA) to estimate the size, concentration, and magnitude of the enrichment of the reads.
After the assessment of read quality, captured library sequencing was implemented on a HiSeq2500 System high-throughput sequencing system (Illumina, San Diego, CA, USA) for 90 cycles per read following the manufacturer’s instructions. Image analysis, error estimation and base calling were performed with Pipeline software (version 1.3.4; Illumina) to generate raw data.

Primers and probes used for genotyping (Table 2) were designed using best practices [25 ]. They were designed to target the regions of each gene where the critical base- pair substitutions occur. Candidate sequences for primers and probes were chosen with PrimerQuest software and assessed for kinetic parameters (Tm, dimerization, hairpin loop formation) using OligoAnalyzer software [26 (link)]. Specificity was confirmed using NCBI BLAST [27 ]. Probes for α1 required locked nucleic acid (LNA) bases surrounding some SNP sites because a standard probe did not show sufficient specificity [28 (link)]. α1 probes were designed with assistance from IDT Application Support (Integrated DNA Technologies). All primers and probes were obtained from IDT. A melt-curve analysis using SYBR Green qPCR was performed to check each pair of primers for off-target amplification or excessive dimerization (Bio-Rad iTaq Universal SYBR Green Supermix, cat. no. 1725121). Each probe was then assessed for its ability to discriminate between wild-type and mutant alleles of its target gene. Candidate probes meeting these criteria were validated on multiple samples of known genotype. RT-PCR was performed using ABI StepOne and StepOnePlus real-time PCR machines (Thermo Fisher).