Abi 7500 fast rt pcr system

Quantitative RT-PCR was performed using the ABI 7500 fast RT-PCR system (Applied Biosystems, Foster City, CA, USA) with SYBR Green PCR Master Mix (Applied Biosystems) as reported previously.^{56 (link)} Complementary DNA reverse transcribed from total RNA was amplified by using primers specific for MCP-1 (sense: 5′-AACTGCATCTGCCCTAAGGT-3′, antisense: 5′-ACGGGTCAACTTCACATTCA-3′), MIP-1α (sense: 5′-AGATTCCACGCCAATTCATC-3′, antisense: 5′-CAGATCTGCCGGTTTCTCTT-3′), RANTES (sense: 5′-GCCCACGTCA AGGAGTATTT-3′, antisense: 5′-TGACAAACACGACTGCAAGA-3′), iNOS (sense: 5′-ACTGTGTGCCTGGAGGTTCT-3′, antisense: 5′-GGCAGCCTCTTGTCTTTGAC-3′) and glyceraldehyde 3-phosphate dehydrogenase (sense: 5′-TGCACCACCAACTGCTTAG-3′, antisense: 5′-GGATGCAGGGATGATGTTC-3′).

Total RNA was extracted from the peripheral blood mononuclear cell (PBMC) using Trizol reagent (Invitrogen). The concentration and quality of the RNA were checked by spectrophotometry and gel electrophoresis. Totally 1 μg RNA was used for reverse transcribed by using the QuantiTect Reverse Transcription Kit (Qiagen). Quantitative real-time PCR (qRT-PCR) was performed using Power SYBR Green PCR Master Mix with ABI 7500 Fast RT-PCR system (Applied Biosystems). The PCR cycling conditions included an initial denaturation step of 95°C for 10 min, 40 cycles at 95°C for 15 s, and 60°C for 1 min. The final primer concentration was 125 nM. The comparative CT method (2-∆∆CT) was used to calculate the relative level of the mRNA normalized to the beta-actin gene. All samples were measured in triplicates. Sequences of forward and reverse primers for NKAPL were 5′-ATGTTCCTCTTGGGATGGC-3’and 5′-AGT​TGC​GGA​ATC​TTG​GGA​G-3′, respectively. Beta-actin gene was measured for normalization.

Quantitative real-time reverse transcription-PCR (qRT-PCR) was performed to analyze the expression pattern of Ha-far-1 (Primers: qHa-far-1F and qHa-far-1R) and Ha-far-2 (Primers: qHa-far-2F and qHa-far-2R) (Table 1) among different developmental stages. The β-actin gene (Primers: ActinF and ActinR) and glyceraldehyde 3 phosphate dehydrogenase gene (Primers: GAPDH-qS1 and GAPDH- qAS1) [37 (link)] (Table 1) were used as a reference gene. One or both of the specific primer pairs crossed two exons. Total RNA was extracted from pre-parasitic J2s, J3s, J4s and mature females of H. avenae, and parasitic J2s were from wheat root infested by H. avenae at 1dpi (day past inoculation). After removal of contaminating genomic DNA by RQ1 RNase-Free DNase (Promega, USA), 1μg total RNA was reverse transcripted into cDNA. The qRT-PCR was carried out with triplicate technical replicas by SYBR qPCR SuperMix-UDG w/ROX (Invitrogen Corporation, Carlsbad, CA, USA) on an ABI 7500 Fast RT-PCR System (Applied Biosystems Inc., USA). The data were analyzed by the ∆∆Ct method and standardized to the β-actin gene expression levels.

Extraction of CC RNA was performed using the TRIZOL reagent (Vazyme Biotech Co., Nanjing, China), according to the manufacturer’s instructions. Using the PrimeScript™ reagent kit (TaKaRa, Bio), 500 ng of the template was reverse transcribed into cDNA. The SYBR green assay system was used for quantitative real-time PCR (qRT-PCR) on an ABI 7500 Fast RT-PCR System (Applied Biosystems, Waltham, MA, USA). Table 1 lists the primers used for qRT-PCR. One cycles at 95 °C for 30 s, 40 cycles at 95 °C for 5 s and 60 °C for 45 s were the reaction conditions. Threshold cycle-based relative measurement was conducted at constant fluorescence intensity. Calculating relative mRNA expression (R): $$R=2^{-[\mathsf{\Delta }Ct sample-\mathsf{\Delta }Ct control]}$$
CCs and MII-stage oocytes normalized each mRNA to β-actin.

CaSki cells (6 × 10⁵ per well) were seeded into 6-well culture plates and incubated for 12 h. Then, various concentrations of L17 were applied in duplicate and incubated for 12, 24, 36 and 48 h. Total cellular RNA was extracted with RNeasy Mini kit (Qia-gen, Germantown, MD, USA) according to the manufacturer’s protocol. The one-step quantitative RT-PCR (qRT-PCR) was conducted with the ABI 7500 Fast RT-PCR system (Applied Biosystems, Foster City, CA, USA) using SuperScript III Platinum SYBR Green One-step RT-PCR Kit (Invitrogen, Carlsbad, California, USA) with the following procedures: 50 °C for 3 min, 95 °C for 15 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 30s [20 (link)]. The mRNA expression of HPV16 E6 was determined using primers (F: 5′-CTGCAATGTTTCAGGACCCA-3, R: 5′-TCATGTATAGTTGTGCAGCTCTGT-3′) targeting HPV-16 E6 open-reading frame. The mRNA expression of HPV16 E7 was determined using primers (F: 5′-GAGGAGGAGGATGAAATAGATGGT-3′,R: 5′-CACTTGCAACAAAACGTT ACAATATTG-3′) targeting HPV-16 E7 open-reading frame. β-actin was determined using primers (F: 5′- CCAACCGCGAGAAGATGA-3′, R: 5′- CCAGAGGCGTACAGGGATAG -3′). The ΔΔCt method was used to represent mRNA fold change [21 (link)].