Log In Sign up
The largest database of trusted experimental protocols

Sybr green chemistry

Manufactured by Vazyme
Visit Supplier
Sourced in China

SYBR Green chemistry is a real-time PCR detection method that uses the SYBR Green I dye to detect and quantify DNA amplification. The dye binds to double-stranded DNA, resulting in a fluorescent signal that is proportional to the amount of DNA present. This method is commonly used for gene expression analysis, quantification of gene targets, and other applications that require real-time monitoring of DNA amplification.

Automatically generated - may contain errors

Lab products found in correlation

High capacity cdna reverse transcription kit, by Vazyme (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Iq5 optical system software v2, by Bio-Rad (1 mentions) Myiq2, by Bio-Rad (1 mentions) Goscript reverse transcription system, by Promega (1 mentions) Origin 2019, by OriginLab (1 mentions) Trizol rna isolation kit, by Thermo Fisher Scientific (1 mentions) Lightcycler 480 system, by Roche (1 mentions)

Close spelling variants of this product

SYBR Green

4 protocols using sybr green chemistry

1

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA was extracted by using Trizol (Ambion, United States). The High Capacity cDNA Reverse Transcription Kit (Vazyme, Nanjing, China) was used to conduct the reverse transcription. SYBR Green chemistry (Vazyme, Nanjing, China) on a 7,500 fast RT-PCR system was used to perform amplified reaction. The primers (Invitrogen Co, Shanghai, China) were listed in Supplementary Table S1. The ratio of the mRNA expression of the target gene vs that of β-actin was defined as 2−△△Ct.
Qian L., Ren S., Xu Z., Zheng Y., Wu L., Yang Y., Wang Y., Li J., Yan S, & Fang Z. (2021). Qian Yang Yu Yin Granule Improves Renal Injury of Hypertension by Regulating Metabolic Reprogramming Mediated by HIF-1α/PKM2 Positive Feedback Loop. Frontiers in Pharmacology, 12, 667433.
+ Open protocol
+ Expand
2

RNA Extraction and qRT-PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The total RNA was extracted by using Trizol (Ambion, USA). The High Capacity cDNA Reverse Transcription Kit (Vazyme, Nanjing, China) was used to conduct the reverse transcription. Thermo Fisher Scientific synthesized the primers, and the primer sequences are summarized in the Table S6. SYBR Green chemistry (Vazyme, Nanjing, China) on a 7500 fast RT-PCR system was used to perform an amplified reaction. The amount of target, normalized to an endogenous reference (β-actin), was given by the 2−ΔΔCT calculation.
Yan S.H., Hu L.M., Hao X.H., Liu J., Tan X.Y., Geng Z.R., Ma J, & Wang Z.L. (2022). Chemoproteomics reveals berberine directly binds to PKM2 to inhibit the progression of colorectal cancer. iScience, 25(8), 104773.
+ Open protocol
+ Expand
3

Quantitative Real-Time PCR Analysis

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
RNAs were extracted as above, and reversed transcribed to cDNA by the GoScript Reverse Transcription System (Promega, A5001) following the manufacturer's instructions. The qRT-PCR reaction was performed by MyiQ2 (BIO-RAD) and analyzed by the iQ5 Optical System Software V2.1 (BIO-RAD) and SYBR Green chemistry (Vazyme). All the PCR results were presented relative to the mean of input data, negative control pie-1 mRNA (39 (link)) and mean of N2 worms (Supplementary data 6 and 7). Primers for qRT-PCR analyses are shown in Supplementary Table S9. The data and figures were analyzed and visualized by Origin 2019 (OriginLab).
Xu Z., Zhao J., Hong M., Zeng C., Guang S, & Shi Y. (2021). Structural recognition of the mRNA 3′ UTR by PUF-8 restricts the lifespan of C. elegans. Nucleic Acids Research, 49(17), 10082-10097.
+ Open protocol
+ Expand
4

Gene Expression Analysis via qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cell samples using a TRIzol RNA isolation kit (Invitrogen), and cDNA was generated following the manufacturer’s instructions (Vazyme Biotech). The expression of the selected genes was determined using the LightCycler 480 System (Roche) and SYBR Green chemistry (Vazyme Biotech). Calculations were performed using the comparative computed tomography method (ΔΔCt method). Fold induction was adjusted for GAPDH levels. A primer list is as follows： GAPDH:
F: CATGAGAAGTATGACAACAGCCT; R: AGTCCTTCCACGATACCAAAGT
MAPK15: F: AGAAGCCGTCCAATGTGCTC; R: CAAGGGTGTATCGGTGCGA
MMP9: F: GGGACGCAGACATCGTCATC; R: TCGTCATCGTCGAAATGGGC
TP53: F: ACAGCTTTGAGGTGCGTGTTT; R: CCCTTTCTTGCGGAGATTCTCT
MKI67: F: GCCTGCTCGACCCTACAGA; R: GCTTGTCAACTGCGGTTGC
Obulkasim H., Aji G., Abudoula A., Liu Y, & Duan S. (2024). Parthenolide induces gallbladder cancer cell apoptosis via MAPK signalling. Annals of Medicine and Surgery, 86(4), 1956-1966.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!