qPCRs were used to assay the copy numbers of pDL278 vector and variants in E. faecium strains (29212-pDL278, EFDO-cls, EF332-cls) to verify the stability of this vector. Plasmid levels were calculated using the 2−ΔΔCt method. 16S rDNA was used as the housekeeping gene. The primers used are listed in Supplementary Table 1 . The qPCR system (20 μl) contains the following: 10 μl of 2× SYBR green premix pro taq HS premix (Accurate Biotechnology Co., Ltd., China), 7.8 μl dd H2O, 0.4 μl of forward and reverse primers each (10 μM), 0.4 μl of ROX reference dye (20 μM, Accurate Biotechnology Co., Ltd., China), and 1 μl template DNA (100 ng/μl). The qPCRs were performed with the following programs: denaturation at 95°C for 30 s, followed by 40 cycles of denaturation at 95°C for 5 s, annealing at 60°C for 30 s. Three biological replicates were performed for each sample, and each qPCR was conducted in triplicate using the ABI StepOnePlus system (Applied Biosystems Inc., Waltham, MA, United States).
Rox reference dye
Manufactured by Accurate Biology
Sourced in China
Rox Reference Dye is a fluorescent dye commonly used in real-time PCR (polymerase chain reaction) experiments as an internal reference. It is typically used to normalize the fluorescent signal from the target gene or sequence of interest, allowing for more accurate quantification of the target.
Automatically generated - may contain errors
Lab products found in correlation
Sybr green premix pro taq hs qpcr kit, by Accurate Biology (5 mentions)
Evo m mlv rt mix kit, by Accurate Biology (3 mentions)
Steadypure quick rna extraction kit, by Accurate Biology (3 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Sybr green premix pro taq hs premix, by Accurate Biology (1 mentions)
Abi steponeplus system, by Thermo Fisher Scientific (1 mentions)
Evo m mlv rt premix for qpcr, by Accurate Biology (1 mentions)
6 protocols using rox reference dye
1
Quantifying Plasmid Stability in Enterococcus
2
KIRC Cell RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We utilized the SteadyPure Quick RNA Extraction Kit (Accurate Biology, China) to extract total RNA from freshly frozen tissues or KIRC cell lines, followed by reverse transcription using the Evo M-MLV RT Mix Kit (Accurate Biology, China). Subsequently, qPCR was conducted with the SYBR® Green Premix Pro Taq HS qPCR Kit and Rox Reference Dye (Accurate Biology, China). The internal reference gene GAPDH was utilized, and the relative expression level of the target gene was determined using the 2−ΔΔCT calculation method. Each experiment was performed in triplicate.
3
Quantifying mRNA Expression in ccRCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Authorized by the ethics committee of the affiliated Yantai Yuhuangding Hospital of Qingdao University (No.2023-314), ccRCC tissues and adjacent normal samples from eight patients who underwent radical or partial nephrectomy were gathered. Two different pathologists independently verified the pathological specimens. Using SteadyPure Quick RNA Extraction Kit (Accurate Biology, China), we extracted total RNA from clinical samples. Subsequently, The SYBR Green Premix Pro Taq HS qPCR Kit and Rox Reference Dye (Accurate Biology, China) were used for the qRT-PCR procedure. Based on the 2®−ΔΔCT calculation method, we calculated the mRNA expression of core genes. For each experiment, three multiple holes were set. The primer sequences used can be found in Supplementary Table 3 .
4
Quantifying RNA Expression via qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We extracted total RNA from freshly frozen tissues or ccRCC cell lines using SteadyPure Quick RNA Extraction Kit (Accurate Biology, China) and then conducted reverse transcription using Evo M-MLV RT Mix Kit (Accurate Biology, China). Next, we carried out qRT-PCR by using SYBR® Green Premix Pro Taq HS qPCR Kit and Rox Reference Dye (Accurate Biology, China). The housekeeping gene GAPDH was used as the internal reference, and the relative expression level of the target gene was calculated by the 2−ΔΔCT calculation method. Three multiple holes were set for each experiment, and the primer sequences used were listed in Table 1
5
Rapid RNA Extraction and qPCR Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We utilized the SteadyPure Rapid RNA Extraction Kit (Accurate Biosciences, China) to extract total RNA from freshly frozen tissues or KIRC cell lines, followed by reverse transcription using the Evo M-MLV RT Mix Kit (Accurate Biology, China). Subsequently, we performed qPCR using the SYBR® Green Premix Pro Taq HS qPCR Kit and Rox Reference Dye (Accurate Biology, China). The internal reference gene, GAPDH, was employed, and the relative expression level of the target gene was estimated using the 2−ΔΔCT computational technique. Each experiment was conducted in triplicate, and the primer sequences used are presented in Table 1 .
Sequence of gene-specific primers for qPCR
| Gene | Forward sequence (5′–3′) | Reverse sequence (5′–3′) |
|---|---|---|
| PRRG2 | GCGCTTTTGGGAGAGCTACATC | CAGCGCAGATACCAAAAGGCTC |
| GAPDH | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA |
6
Quantifying Gene Expression in Immune Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA isolation and mRNA levels for specific genes in macrophages, livers and intestine were performed using a real-time quantitative polymerase chain reaction (RT-qPCR) assay. Total RNA was extracted using Trizol reagent (Thermo Fisher Scientific, United States). cDNA was synthesized with 0.25 μg total RNA by using the Evo M-MLV RT Premix for qPCR (Accurate Biology, China). DNA amplification was performed using the SYBR Green Premix Pro Taq HS qPCR Kit (Accurate Biology, China) with 0.5 μl of ROX reference dye (Accurate Biology, China) and performed in a StepOnePlus Real-Time PCR system (Thermo Fisher Scientific, United States) using SYBR Green detection chemistry with the resulting cDNAs. The primers sequences used were shown in Table 1 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!