Apoptotic cells were determined by flow cytometry using Annexin V-FITC Apoptosis Detection Kit (Beyotime Biotechnology, Jiangsu, China) according to the manufacturer’s protocol. After treated with FLC/ISRIB for 6 h, TM4 cells were collected by Trypsin-EDTA solution (Beyotime Biotechnology, Jiangsu, China) and resuspended in 195 μL annexin-binding buffer. Then cells were incubated with 5 μL Annexin V and 10 μL PI in the dark for 15 min. Apoptotic cells were detected by BD LSRFortessa flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) and the apoptotic rates were calculated by FlowJo software (v10.0.7r2, BD Biosciences, Franklin Lakes, NJ, USA).
Trypsin edta solution
Manufactured by Beyotime
Sourced in China
Trypsin-EDTA solution is a cell culture reagent used for the dissociation and detachment of adherent cells from culture vessels. It contains trypsin, a proteolytic enzyme, and EDTA, a chelating agent, which work together to break down the cell-to-cell and cell-to-substrate adhesions, allowing the cells to be easily removed from the surface.
Automatically generated - may contain errors
Lab products found in correlation
Penicillin streptomycin solution, by Beyotime (4 mentions)
Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (4 mentions)
Ripa lysis buffer, by Beyotime (4 mentions)
Penicillin streptomycin, by Beyotime (3 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (3 mentions)
Annexin 5 fitc apoptosis detection kit, by Beyotime (2 mentions)
Triton x 100, by Merck Group (2 mentions)
Dimethyl sulfoxide (dmso), by Merck Group (2 mentions)
Hoechst 33258, by Beyotime (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Lsrfortessa flow cytometer, by BD (1 mentions)
N n methylenebisacrylamide, by Merck Group (1 mentions)
Tetramethylethylenediamine, by Merck Group (1 mentions)
Streptomycin, by Beyotime (1 mentions)
Penicillin, by Beyotime (1 mentions)
Myogenin myog, by Cell Signaling Technology (1 mentions)
Ecl plus kit, by Advansta (1 mentions)
β actin antibody, by Bioss Antibodies (1 mentions)
Dulbecco modified eagle medium (dmem), by Corning (1 mentions)
Methyl thiazolyl tetrazolium (mtt), by Beyotime (1 mentions)
40 protocols using trypsin edta solution
1
Flow Cytometric Analysis of Apoptosis
2
PLGA-based Scaffold Fabrication
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PLGA (obtained from Dai Gang, Beijing Shi, China; molecular weight [Mw] =5×105 Da, l -lactide/glycolide ratio =75:25) was used as the scaffold polymer. N,N-dimethylformamide ([DMF]; obtained from the Chinese Medicine Group, SINO-PHARM, Beijing, China) was used as the solvent. DMEM and horse serum (HS) were purchased from Hyclone (Logan, UT, USA). Penicillin (100 units/mL), streptomycin (100 mg/mL), and trypsin-EDTA solution were purchased from Beyotime (Shanghai, China). FBS, ammonium persulfate, and PBS were purchased from Grand Biological Technology Co., Ltd (Shijiazhuang, China). Specific primary antibodies for glyc-eraldehyde-3-phosphate dehydrogenase (GAPDH), myosin heavy chain (MyHC), and myogenin (MyOG) were purchased from Cell Signaling Technology (Beverly, MA, USA). Secondary antibodies (horseradish peroxidase [HRP]-conjugated anti-rabbit or anti-mouse) were purchased from TransGene Biotech (Beijing, China). An ECL-plus kit was purchased from Advansta (MenloPark, CA, USA). Nonfat milk was purchased from Difco (Franklin Lakes, NJ, USA). Triton X-100, tetramethylethylenediamine, and N,N-methylene bisacrylamide were obtained from Sigma (Shanghai, China). Alexa Fluor 568-Phalloidin and ProLong Gold Antifade Reagent, paraformaldehyde, and DAPI were purchased from Biotopped Science & Technology Co. Ltd. (Beijing, China).
3
Tet-induced Apoptosis and Cell Cycle Arrest in HT-29 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tet (purity 99.1%) was purchased from Alphabio Biotechnology Co. Ltd (Tianjin, China). The HT-29 cell line was obtained from Cell Bank of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences (Shanghai, China). DMEM was purchased from Corning Cellgro Inc. (Herndon, VA, U.S.A.) and the fetal bovine serum (FBS) was obtained from Biological Industries Technologies (Kibbutz Beit Haemek, Israel). DMSO and MTT were acquired from Beyotime Biotechnology Co., Ltd. (Shanghai, China). Trypsin-EDTA solution, penicillin-streptomycin solution, mitochondrial membrane potential (MMP) assay kit with JC-1, caspase 3, 8 activity assay kit, and propidium iodide (PI)/RNase staining solution were obtained from Beyotime Biotechnology Co., Ltd. (Shanghai, China). FITC goat anti-rabbit IgG and Annexin V-FITC Apoptosis Detection Kit were acquired from Tianjin Sungene Biotech Co. Ltd. (Tianjin, China). Anti-Bax, anti-Bcl-2, anti-caspase 3, anti-caspase 8, anti-PARP, anti-cyclin D1 (anti-CCND1), anti-cyclin-dependent kinase 4 (anti-CDK4), anti-phosphorylated Rb (anti-p-Rb) (Ser780), and β-actin antibodies were purchased from Bioss Biotechnology Co. Ltd. (Beijing, China).
4
Isolation and Culturing of Rat Ventricular Myocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hearts from 1‐ to 3‐day‐old Wistar rats were excised, and the ventricular myocardium was minced in Dulbecco's modified Eagle's medium (DMEM, Invitrogen) and cells were dissociated with 0.25% trypsin‐EDTA solution (Beyotime, China). After centrifugation, the collected isolated cells were plated onto 25 cm2 cell culture flask (Corning Incorporated, USA) for 100 minutes to separate ventricular myocytes from the faster attaching non‐myocytes. The re‐collected cells were then seeded in a six‐well plate (2 × 105/well) in DMEM containing 10% foetal bovine serum (FBS) and 0.1 mmol/L bromodeoxyuridine (sigma). Cells were used for experiments 48‐72 hours after isolation when demonstrating rhythmic contractions.
5
Cytotoxicity Assay of Frying Oils
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Frying oils was provided by Yihai Kerry (Shanghai, China). Silicon for chromatography was from Qingdao Haiyang Chemical Co., Ltd (Qingdao, Shandong, China). HepG2 cells were provided by School of Medicine & Pharmaceutics, Jiangnan University (Wuxi, Jiangsu, China). MTT [3-(4,5-dimethylthiazol-2-yl)-2,5- diphenytetrazolium-bromide] and DMSO (dimethyl sulfoxide) were purchased from Sigma (St. Louis, MO, USA). Hoechst 33258 Kit, Trypsin-EDTA Solution, Cell Cycle and Apoptosis Analysis Kit were from Beyotime (Shanghai, China). Fetal calf serum (FCS) and RPMI1640 were purchased from Gibco (Gaithersburg, MD, USA).
6
Protein Extraction and Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were harvested using Trypsin-EDTA solution (Beyotime Institute of Biotechnology, Jiangsu, China), washed with PBS twice (15,000 × g, 4°C, 5 min) and lysed with radioimmunoprecipitaiton lysis buffer (Beyotime Institute of Biotechnology, Jiangsu, China) on ice. The proteins from the lysed cells were extracted with centrifugation (15,000 × g, 4°C, 10 min). The protein concentrations were determined using an Evolution 60S UV-Visible spectrophotometer (Thermo Fisher Scientific, Inc.). A sample of 30 µg from each protein extract was separated using 8–12% SDS-PAGE, followed by western blot analysis using the previously described antibodies (dilution of antibodies: ERK1/2, JNK and β-actin: 1:1,000, P-ERK and P-JNK: 1:2,000, E-cadherin and β-catenin: 1:500). The membranes were incubated with primary antibody overnight at 4°C and washed with PBST three times for 10 min each time. Next the membranes were incubated with secondary antibody (Beijing CoWin Bioscience Co., Ltd.) for 1 h at room temperature. The relative protein level in the groups was normalized to a β-actin loading control. The gels were captured by Image Lab 3.0 software (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The mean gray values were quantified using Gel-Pro Analyzer 4.0 (Media Cybernetics, Inc., Rockville, MD, USA).
7
TGF-β1 Stimulation of Lung Adenocarcinoma Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The human lung adenocarcinoma (LUAD) cell lines A549 and H1299 were obtained from the experimental Medicine Center, at the affiliated hospital of Southwest Medical University (Luzhou, China). The human astrocyte cell line HA1800 was obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All cells were maintained at 37°C in 5% CO2. Unless otherwise noted, cells were cultured in complete medium containing RPMI 1640 (Hyclone, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, USA) and penicillin/streptomycin (Beyotime Biotechnology, China). Depending on the cell line, the cultures were passaged every 3–4 days using Trypsin-EDTA Solution (Beyotime Biotechnology) for cell detachment. Confluent cultures of A549 cells were maintained in RPMI containing 0.1% FBS for 24 h prior to stimulation with recombinant human TGF-β1 (PeproTech, USA) and then stimulated with 5 ng/ml of TGF-β1 for 48 h.
8
Esophageal Cancer Cell Lines: Cultivation and POU5F1B Inhibition
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human esophageal cancer cell lines (ECA109, ECA9706, KYSE410, and KYSE510) and a normal esophageal epidermis cell line (HEEPIC) were purchased from ATCG and cultured in RPMI-1640 medium (10% FBS). The atmosphere of the culture chamber kept at 37°C and 5% CO2. Pancreatic enzymes were used to digest cells at cell fusion of 85%. RPMI-1640 medium was from Gibco (USA), 0.1% crystal violet staining solution was from Solarbio (USA), and cell culture flasks and culture plates were acquired from Corning (USA). The inhibitor of POU5F1B (GAAGAGTTCCTAACACATTCA) was synthesized by GenePharma (China), Lipofectamine 2000 and Trizol were purchased from Invitrogen (USA), the RT-PCR kit was bought from Takara (Japan), and the penicillin-streptomycin, trypsin-EDTA solution, cell cycle kit, apoptosis assay kit, and annexin V-FITC apoptosis detection kit were from Beyotime Biotechnology (China).
9
Cell Culture Protocols for Respiratory and Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Human bronchial epithelioid cells (16‐HBE) and human laryngeal cancer cells (TU212 and AMC‐HN‐8) were obtained from the BeNa Culture Collection (BNCC), all of which were cultured routinely in high glucose Dulbecco's modified Eagle's medium (H‐DMEM, HyClone) containing 10% fetal bovine serum (Biological Industries). Human umbilical vein endothelial cells (HUVECs) were purchased from the American Type Culture Collection (ATCC) and were cultured in endothelial cell medium (ECM; ScienCell). When the cells reached 90% confluency, they were passaged with a 0.25% trypsin‐EDTA solution (Beyotime Biotechnology). The cells were cultured in a humidified incubator at 37°C under an atmosphere with 5% CO2 in air (Thermo Fisher).
10
Steviol Anticancer Properties Evaluation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Steviol (99% of purity, HPLC) was purchased from Sigma-Aldrich Co., Ltd. (Shanghai, China). 5-Fluorouracil (5-FU), dimethyl sulfoxide (DMSO), Na2CO3, NaHCO3, NaCl, KCl, Na2HPO4·12H2O, NaH2PO4·2H2O, EDTA disodium, dodecyl sodium sulfate (SDS), glycine, bromoxylenol blue, ammonium persulphate, tris (hydroxymethyl) methyl amino methane, ponceau, N,N,N, N-tetramethylethylenediamine (TEMED), xylene brilliant cyanin G (BS, G250), and phenylmethylsulfonyl fluoride (PMSF) were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China). Trypsin-EDTA solution, propidium iodide (PI), triton X-100, endonuclease (RNase A), 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), penicillin-streptomycin solution (100X), bovine albumin (BSA), BeyoECL Plus, polyvinylidene fluoride, RIPA lysis buffer, and 5,5',6,6'-tetrachloro-1,1',3,3'-tetraethyl-imidacarbocyasix iodide (JC-1) were purchased from Beyotime Biotechnology Co., Ltd. (Shanghai, China). DMEM medium, fetal bovine serum were purchased from Gibco Life Technologies Corporation (Carlsbad, CA, USA). Primary antibodies against p21, p53, cyclin D1, Bax, Bcl-2, caspase 3, β-actin, and horseradish peroxidase (HRP)-conjugated secondary antibodies were purchased from Cell Signal Technologies Inc. (Beverly, MA, USA). All other reagents were of analytical grade and used as received unless otherwise stated.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!