Recombinant mouse ifn β

Manufactured by PBL Assay Science

Sourced in United States

Recombinant mouse IFN-β is a laboratory reagent used for experimental purposes. It is a protein produced through recombinant DNA technology, representing the interferon-beta protein found in mice.

Automatically generated - may contain errors

Lab products found in correlation

Cycloheximide (chx), by Merck Group (2 mentions) Abts elisa development kit, by Thermo Fisher Scientific (1 mentions) B16 blue ifn α β reporter cells, by InvivoGen (1 mentions) Quanti blue, by InvivoGen (1 mentions) Puromycin, by Merck Group (1 mentions) Ifn β, by Thermo Fisher Scientific (1 mentions) Cd127 a7r34, by BioLegend (1 mentions) Recombinant mouse tnf, by Thermo Fisher Scientific (1 mentions) Ag490, by Bio-Techne (1 mentions) Fludarabine, by Bio-Techne (1 mentions) Recombinant human ifn λ2, by Thermo Fisher Scientific (1 mentions) Recombinant mouse ifn λ2, by Thermo Fisher Scientific (1 mentions) Pyridone 6, by Abcam (1 mentions) Vero cell, by American Type Culture Collection (1 mentions) Streptomycin, by Corning (1 mentions) Penicillin, by Corning (1 mentions) L glutamine, by Corning (1 mentions) Sodium pyruvate, by Corning (1 mentions) M csf, by Thermo Fisher Scientific (1 mentions) Murine tnf α, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

IFN-β (135 citations) Mouse IFN-β (19 citations) Recombinant IFN-β (9 citations)

10 protocols using recombinant mouse ifn β

Quantifying Inflammatory Cytokines and Type I IFN

Check if the same lab product or an alternative is used in the 5 most similar protocols

Infections were performed in 12-well plates. Supernatants from infected cells were collected at the indicated time points in the figure legends, and spun down at 12,000 × g for 5 min to remove any debris. TNF-α (#900-K54), IL-1β (#900-K47), IL-10 (#900-K53) and IP-10 (CXCL10) (#250-16) in the supernatants were quantified using ABTS ELISA Development Kit (PeproTech) according to the manufacturer’s instructions. All experiments were performed in duplicate, and three independent experiments were conducted.
For quantification of type I IFN (INF-α/β) in the supernatants of iBMDMs, cells were infected for 16 h, and supernatants were collected. Murine type I IFNs were detected using B16-Blue IFN-α/β reporter cells (InvivoGen) which carry an SEAP reporter gene under the control of the IFN-α/β-inducible ISG54 promoter and that have an inactivation of the IFN-γ receptor. Supernatants from iBMDM cells were incubated with the reporter cell line, and levels of SEAP in the supernatants were determined using the detection medium QUANTI-Blue (InvivoGen) after 24 h as per the manufacturer’s instructions using recombinant mouse IFN-β (PBL Assay Science, catalogue number 12401-1) as a standard. Experiments were run in duplicates and repeated at least three times. Results are expressed as OD at 655 nm.

Feriotti C., Sá-Pessoa J., Calderón-González R., Gu L., Morris B., Sugisawa R., Insua J.L., Carty M., Dumigan A., Ingram R.J., Kissenpfening A., Bowie A.G, & Bengoechea J.A. (2022). Klebsiella pneumoniae hijacks the Toll-IL-1R protein SARM1 in a type I IFN-dependent manner to antagonize host immunity. Cell Reports, 40(6), 111167.

+ Open protocol

+ Expand

Immune Cell Profiling by Flow Cytometry

Check if the same lab product or an alternative is used in the 5 most similar protocols

For flow cytometry and sorting experiments, antibodies to CD4 (RM4-4), NK1.1 (PK136), CD49b (DX5), CD3 (17A2), Ly6G (1A8), B220 (RA3-6B2), CD11c (N418), CD45.2 (104), CD45.1 (A20), CX3CR1 (SA011F11), IA^b (AF6-120.1), CD11b (Mac1), CD90 (G7), lineage markers (17A2/RB6-8C5/RA3-6B2/Ter-119/M1/70), and CD127 (A7R34) were purchased from BioLegend. To stimulate neutrophils in vitro and for in vivo administration, we used either recombinant mouse IFN-λ2 (purchased from Peprotech) or recombinant mouse IFN-λ2 to which polyethylene glycol was attached (provided by Bristol-Myers Squibb). Recombinant mouse IFN-β was purchased from PBL interferonsource. Recombinant human IFN-λ2 and IFN-β were purchased from Peprotech. Puromycin was purchased from Sigma. Where indicated, specific chemical inhibitors were used. To inhibit protein synthesis, cycloheximide (Sigma) was used at a concentration of 10 μg/ml. To inhibit Jak signaling, pyridone 6 (BioVision) was used. To inhibit STAT-1 signaling, fludarabine (Tocris) was used. To inhibit Jak2 signaling, either AG490 (Tocris) or 1,2,3,4,5,6-hexabromocyclohexane (HBC, Tocris) was used. To stimulate neutrophils, either E. coli LPS (Serotype O55:B5 TLR grade, purchased from Enzo) or recombinant mouse TNF (Peprotech) was used.

Broggi A., Tan Y., Granucci F, & Zanoni I. (2017). IFN-λ suppresses intestinal inflammation by non-translational regulation of neutrophil function. Nature immunology, 18(10), 1084-1093.

+ Open protocol

+ Expand

Oncolytic HSV Replication in RMS Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Mouse or human RMS cells were plated in 24-well dishes at 2 × 10⁵ cells per well and then infected with 100 µl oncolytic HSV rRp450 at MOI 0.01. Following a 2-hour incubation with gentle shaking every 20 minutes, both cells and supernatants were harvested at 2, 24, 48, and 72 hours postinfection. Samples were freeze-thawed three times, diluted, and titered on Vero cells (ATCC) by standard plaque assay. For experiments addressing the effect of IFN on virus replication, mouse RMS cells were treated for 12 hours with 10–1,000 U of recombinant mouse IFN-β (PBL Assay Science, Piscataway, NJ) prior to infection with the oncolytic virus rRp450 at MOI 0.01, and total infectious virus was measured by standard plaque assay at the indicated times postinfection.

Leddon J.L., Chen C.Y., Currier M.A., Wang P.Y., Jung F.A., Denton N.L., Cripe K.M., Haworth K.B., Arnold M.A., Gross A.C., Eubank T.D., Goins W.F., Glorioso J.C., Cohen J.B., Grandi P., Hildeman D.A, & Cripe T.P. (2015). Oncolytic HSV virotherapy in murine sarcomas differentially triggers an antitumor T-cell response in the absence of virus permissivity. Molecular Therapy Oncolytics, 1, 14010-.

+ Open protocol

+ Expand

IFN-β Regulation of CXCL1 Promoter

Check if the same lab product or an alternative is used in the 5 most similar protocols

Thioglycolate-elicited mouse macrophages were pretreated with medium alone or medium plus 100 U/ml recombinant mouse IFN-β (PBL) for 3 h. Subsequently, 100 ng/ml P3C or 100 ng/ml LPS was added for an additional 3 h. RNA polymerase II recruitment to the CXCL1 promoter was determined by a chromatin immunoprecipitation (ChIP) assay using a ChIP IT Expresses-Enzymatic kit from Active Motif according to the manufacturer’s instructions. Briefly, macrophages were fixed and DNA was fragmented by enzymatic digestion. RNA Pol II immunoprecipitation was carried out overnight at 4°C using a monoclonal antibody directed against mouse RNA Pol II (Active Motif). Precipitated CXCL1 DNA fragments were quantified by PCR using primers amplifying a region of the CXCL1 promoter region: CCTCTTCACATGCCTCCCTG (forward) and CGGGGATGGAAGCTTGTCTT (reverse). Changes in CXCL1 were normalized to the changes in the control gene actin by use of the primers CCTCTGGGTGTGGATGTCAC (forward) and TGTCCATTCAATCCAGGCCC (reverse).

Shirey K.A., Perkins D.J., Lai W., Zhang W., Fernando L.R., Gusovsky F., Blanco J.C, & Vogel S.N. (2019). Influenza “Trains” the Host for Enhanced Susceptibility to Secondary Bacterial Infection. mBio, 10(3), e00810-19.

+ Open protocol

+ Expand

Stimulation of Lung Epithelial Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

MLE‐12 lung epithelial cells were obtained from ATCC (#CRL‐2110) and cultured in DMEM with 4.5 g/l glucose, l‐glutamine, and sodium pyruvate (Corning #10‐013‐CV) supplemented with 10% fetal bovine serum, 100 IU/ml penicillin, 100 μg/ml streptomycin (Corning #30‐002‐CI), and 2 mM l‐glutamine (Corning #25‐005‐CI) at 37°C at 5% CO₂. For stimulations, MLE‐12 cells were incubated with 1 U/ml or 10 U/ml recombinant mouse IFN‐β (PBL Assay Science #12401‐1) and 100 ng/ml recombinant mouse IL‐28B/IFN‐λ3 (R&D Systems #1789‐ML‐025/CF). For select experiments, cells were also incubated with 10 μg/ml cycloheximide (Sigma‐Aldrich #C7698) or a vehicle (ethanol) control.

Wilder C.L., Lefaudeux D., Mathenge R., Kishimoto K., Zuniga Munoz A., Nguyen M.A., Meyer A.S., Cheng Q.J, & Hoffmann A. (2023). A stimulus‐contingent positive feedback loop enables IFN‐β dose‐dependent activation of pro‐inflammatory genes. Molecular Systems Biology, 19(5), e11294.

+ Open protocol

+ Expand

Murine Cytokine and IFN-beta Assays

Check if the same lab product or an alternative is used in the 5 most similar protocols

Murine TNF-α and M-CSF were purchased from Peprotech. Recombinant mouse IFN-β was from PBL Assay Science. The control IgG (rabbit) was obtained from Santa Cruz Biotechnology, and IFN-β neutralizing antibody (rabbit polyclonal antibody against mouse interferon-beta) was from PBL Assay Science. Mouse IFN Alpha All Subtype ELISA Kit and VeriKine-HS Mouse IFN Beta ELISA Kit were purchased from PBL Assay Science. MojoSort Mouse CD45 Nanobeads were obtained from Biolegend.

Deng Z., Ng C., Inoue K., Chen Z., Xia Y., Hu X., Greenblatt M., Pernis A, & Zhao B. (2020). Def6 regulates endogenous type-I interferon responses in osteoblasts and suppresses osteogenesis. eLife, 9, e59659.

+ Open protocol

+ Expand

Examining Cell Death Mechanisms

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Purified LPS was purchased from InvivoGen (San Diego, CA). AT-406 was synthesized as described^{65 (link)}. Flag-M2 antibodies, Flag-M2 beads, necrostatin-1 (Nec-1), cycloheximide (CHX), thapsigargin (THAP), propidium iodide (PI) and (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) (MTT) were purchased from Sigma (St. Louis, MO). JNK inhibitor II (SP600125) and DMSO were purchased from Merck Millipore (Billerica, MA). Annexin V-Cy5 was obtained from BD-Biosciences (Franklin Lakes, NJ). Recombinant GM-CSF was purchased from R&D (Minneapolis, MN, USA). z-VAD-FMK was obtained from Bachem (Bubendorf, Switzerland). Recombinant mouse and human TNF were purchased from PeproTech (Rocky Hill, NJ, USA). Recombinant mouse IFNβ was purchased from PBL Assay Science (Piscataway, NJ, USA). BV6 was purchased from Selleck Chemicals (Houston, TX). Recombinant human Fas ligand (FLAG-FasL) was purchased from Enzo Life Sciences (Farmingdale, NY, USA). CellTiter-Glo^® Luminescent Cell Viability Assay was purchased from Promega (Fitchburg, Wisconsin). Lipofectamine 2000 was purchased from Thermo Fisher Scientific (Waltham, MA, USA). Constructs of p38α MAPK and active MKK3 (MKK3b(Glu¹⁸⁹, Glu¹⁹³)) were gifts of Dr. Jiahuai Han (Xiamen University, China).

Wu Y.H., Chou T.F., Young L., Hsieh F.Y., Pan H.Y., Mo S.T., Brown S.B., Chen R.H., Kimchi A, & Lai M.Z. (2020). Tumor suppressor death-associated protein kinase 1 inhibits necroptosis by p38 MAPK activation. Cell Death & Disease, 11(5), 305.

+ Open protocol

+ Expand

Experimental Autoimmune Encephalomyelitis Mouse Model

Check if the same lab product or an alternative is used in the 5 most similar protocols

Eight to ten weeks old, female C57BL6/J and muMT mice were induced with EAE by an immunization with 150μg of MOG p35–55 (Stanford) emulsified in CFA (4mg/ml of heat-killed m. tuberculosis) followed by an intraperitoneal injection of 500 ng Bordetella pertussis toxin (Difco laboratories) in PBS at the time of and two days following immunization. Paralysis were monitored daily using a standard clinical score ranging: 1) Loss of tail tone, 2) incomplete hind limb paralysis, 3) complete hind limb paralysis, 4) forelimb paralysis, 5) moribund/dead. Mice were treated every second day with 10,000 units per dose of recombinant mouse IFN-β (PBL) or vehicle (0.5% albumin in PBS) from EAE day 6 to day 20.

Schubert R.D., Hu Y., Kumar G., Szeto S., Abraham P., Winderl J., Guthridge J.M., Pardo G., Dunn J., Steinman L, & Axtell R.C. (2015). Interferon-β treatment requires B cells for efficacy in neuro-autoimmunity.. Journal of immunology (Baltimore, Md. : 1950), 194(5), 2110-2116.

+ Open protocol

+ Expand

Quantification of H2O2 in iBMDMs

Check if the same lab product or an alternative is used in the 5 most similar protocols

WT and Ifnar1^-/- iBMDMs were either infected with wt J2315 at an MOI of 10, as above, stimulated with heat-killed wt J2315 at the equivalent of an MOI of 10, or stimulated with 1000 U/mL of recombinant mouse IFNβ (PBL Assay Science) for 24 h. H₂O₂ quantification was performed using the ROS Glo H2O2 Assay kit (Promega) according to manufacturer’s directions, adding the H₂O₂ substrate solution for the final 6 h of infection/stimulation. Luminescence was quantified using a FLUOstar microplate reader (BMG Labtech).

Dorrington M.G., Bradfield C.J., Lack J.B., Lin B., Liang J.J., Starr T., Ernst O., Gross J.L., Sun J., Miller A.H., Steele-Mortimer O, & Fraser I.D. (2021). Type I IFNs facilitate innate immune control of the opportunistic bacteria Burkholderia cenocepacia in the macrophage cytosol. PLoS Pathogens, 17(3), e1009395.

+ Open protocol

+ Expand

Maternal IFNβ Administration in Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

On E14.5, pregnant females were i.v. injected with a single dose of 22,700 U [61 (link)] or 45,400 U recombinant mouse IFNβ (PBL Assay Science, NJ, USA) dissolved in 100 µl vehicle (PBS supplemented with 0.1% FCS), or an equivalent volume of vehicle as a control.

Ben-Yehuda H., Matcovitch-Natan O., Kertser A., Spinrad A., Prinz M., Amit I, & Schwartz M. (2019). Maternal Type-I interferon signaling adversely affects the microglia and the behavior of the offspring accompanied by increased sensitivity to stress. Molecular Psychiatry, 25(5), 1050-1067.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!