Competence stimulating peptide 1 csp1

Transformations were carried out as previously described (7 (link)). Briefly, mid-logarithmic-phase cultures of the recipient strain were diluted 1:20 in competence medium (Todd-Hewitt broth; Oxoid, Basingstoke, United Kingdom) containing 1 mM calcium chloride (Sigma Aldrich Ltd., Dorset, United Kingdom), 0.2% bovine serum albumin (BSA; Sigma Aldrich Ltd., Dorset, United Kingdom), and 100 ng/ml competence-stimulating peptide 1 (CSP1; Mimotopes, Clayton, Victoria, Australia). Donor DNA was added at various concentrations to 500-µl aliquots of a competent cell suspension. Transformation reaction mixtures were incubated for 3 h at 37°C, and then 20-μl and 200-μl volumes were spread onto selective agar plates. Viable counts were determined in parallel to allow estimation of the transformation frequency.

Briefly, mid-logarithmic phase cultures of S. oralis were diluted 1:20 in complete medium (Brain Heart Infusion, Becton, Dickinson, and Co.) containing 1 mM calcium chloride, 0.2% BSA (Sigma Aldrich Ltd, Dorset, UK) and 100 ng/mL competence-stimulating peptide 1 (CSP1; Mimotopes, Clayton, Victoria, Australia). The transformation reactions were incubated for 90 s at 42 °C and placed on ice for 2 min. Then, the sensory bacteria were transferred to 6-well plate with ampicillin for 16 h. The primers were designed for GFP (forward primer: GACCGTCTACCCCAGTGTTT; reverse primer: CGGCAGTCCACGTCATTTC).

Transformation of S. pneumoniae R6 was carried out as described previously.^{7 (link)} Briefly, mid-logarithmic phase cultures of R6 were diluted 1 : 20 in competence medium [Todd–Hewitt broth (Oxoid, Basingstoke, UK) containing 1 mM calcium chloride (Sigma Aldrich Ltd, Dorset, UK), 0.2% BSA (Sigma Aldrich Ltd, Dorset, UK) and 100 ng/mL competence-stimulating peptide 1 (CSP1; Mimotopes, Clayton, Victoria, Australia)]. For whole-genome transformation, genomic DNA from the donor strain was added to a final concentration of 0.2 mg/L to aliquots of the competent cell suspension. For transformation with PCR amplimers, 20 μL of purified PCR amplimer was added to 500 μL of cell suspension. Transformation reactions were incubated for 3 h at 37°C, then 20 and 200 volumes were spread onto agar plates containing 8 mg/L ethidium bromide. Viable counts were determined in parallel to allow estimation of the transformation frequency.