Sybr green qpcr supermix

The mRNA expression levels of MEIS2 and its associated‐genes were quantified using real‐time polymerase chain reaction (qRT‐PCR) analyses. Briefly, Qiagen RNeasy Mini Kit (Qiagen) was used to purify total RNA from cells according to the manufacturer's protocol. The reverse transcription was conducted with high‐capacity cDNA Reverse Transcription Kit (Thermo Fisher) to obtain cDNA from the extracted RNA. SYBR Green qPCR Supermix (Solis BioDyne) was used for the real‐time PCR according to the manufacturer's protocol on BIO‐RAD iQ5 real‐time PCR Detection System (BIO‐RAD). The mRNA levels of MEIS2 and its potentially regulating genes were normalized to the housekeeper gene GAPDH. Graphpad Prism 5 software was applied to perform Two‐tailed and unpaired t‐tests. The sequences of primers used for real‐time PCR were as following: MEIS2‐F: GAAAAGGTCCACGAACTGTGC, MEIS2‐R: CTTTCATCAATGACGAGGTCGAT; IL10‐F: GACTTTAAGGGTTA CCTGGGTTG, IL10‐R: TCACATGCGCCTTGATGTCTG;GAPDH‐F: AAGGT GAAGGTCGGAGTCAAC, GAPDH‐R: GGGGTCATTGATGGCAACA ATA.

The mRNA level of INMT was quantified using real-time polymerase chain reaction (RT-PCR) analysis. In brief, total RNA was purified from PPC and CRPC tissues using Qiagen RNeasy Mini Kit (Qiagen) according to the manufacturer’s recommendations. The cDNA was synthesized from the extracted RNA by reverse transcription using High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher). Quantitative real-time PCR (qRT-PCR) was performed using SYBR Green qPCR Supermix (Solis BioDyne) according to the manufacturer’s protocol on BIO-RAD iQ5 real-time PCR Detection System (BIO-RAD). The mRNA level of INMT was normalized to the housekeeper gene GAPDH. The primers used for qRT-PCR were listed as following: mINMT-F: CCTACGACTGGTCCTCCATAGTG, mINMT-R: CTTCTGAGCTTGGCTTCCTTCT; mGAPDH-F: AGGTCGGTGTGAACGGATTTG, mGAPDH-R: TGTAGACCATGTAGTTG AGGTCA.